Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29175
Trapped Gene
St8sia1 (ENSMUSG00000030283)
Vector Insertion
Chr 6: 142777791 - 142816373
Public Clones not available
Private Clones OST6681 (lexicon)
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000197047 (Chr6:142816374..142816466 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACACCAGAGATGTCGGTTCC Chr6:142816418..142816437 59.97 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000197047 (Chr6:142816374..142816466 -)
Downstram Exon
ENSMUSE00000341920 (Chr6:142770061..142777790 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACACCAGAGATGTCGGTTCC Chr6:142816418..142816437 59.97 55 CAGACTCTAGGCCATGCACA Chr6:142776174..142776193 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336487 Chr6:142912056..142912972 GGCGAAGATCCTTGTAGCTG Chr6:142912449..142912468 59.98 55
upstream ENSMUSE00000294871 Chr6:142862544..142862688 AAGAGCCTGTGGTACGATGG Chr6:142862599..142862618 60.13 55
upstream ENSMUSE00000197044 Chr6:142825168..142825277 GCTGTGGCCGTCAAATAGAT Chr6:142825188..142825207 60.1 50
upstream ENSMUSE00000197047 Chr6:142816374..142816466 ACACCAGAGATGTCGGTTCC Chr6:142816418..142816437 59.97 55

*** Putative Vector Insertion (Chr 6: 142777791 - 142816373) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000341920 Chr6:142770061..142777790 CAGACTCTAGGCCATGCACA Chr6:142776174..142776193 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr6:142783303..142783323 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGTTCCCTTCTGTCTTGC Chr6:142783372..142783392 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030283