Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29180
Trapped Gene
Rpl18 (ENSMUSG00000059070)
Vector Insertion
Chr 7: 52974710 - 52974898
Public Clones not available
Private Clones OST6580 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000517867 (Chr7:52974623..52974709 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACAACAAGGACCGAAAGGT Chr7:52974638..52974657 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000517867 (Chr7:52974623..52974709 +)
Downstram Exon
ENSMUSE00000520562 (Chr7:52974899..52975006 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACAACAAGGACCGAAAGGT Chr7:52974638..52974657 60.01 50 GTTCGGCTCATGAACAACCT Chr7:52974978..52974997 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674277 Chr7:52970827..52971212 GGGAGGCTCATGGACTTACA Chr7:52971100..52971119 60.07 55
upstream ENSMUSE00000674276 Chr7:52971518..52973509 GTTTACTCGGTCCTCCCACA Chr7:52973294..52973313 59.97 55
upstream ENSMUSE00000674278 Chr7:52973474..52973509 No primer for this exon
upstream ENSMUSE00000517867 Chr7:52974623..52974709 CACAACAAGGACCGAAAGGT Chr7:52974638..52974657 60.01 50

*** Putative Vector Insertion (Chr 7: 52974710 - 52974898) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000520562 Chr7:52974899..52975006 GTTCGGCTCATGAACAACCT Chr7:52974978..52974997 60.12 50
downstream ENSMUSE00000515956 Chr7:52975290..52975388 AATCCGCACATCATCTGTGA Chr7:52975370..52975389 60.08 45
downstream ENSMUSE00000500647 Chr7:52975664..52975857 CTTGCCAAAATGTCGGTACA Chr7:52975831..52975850 59.58 45
downstream ENSMUSE00000512079 Chr7:52976084..52976204 No primer for this exon
downstream ENSMUSE00000513613 Chr7:52976084..52976200 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGCTGCTTGTCAAGGTAAG Chr7:52974696..52974716 60.95 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGCTGCTTGTCAAGGTAAG Chr7:52974696..52974716 60.95 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059070