Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29183
Trapped Gene
Rab6b (ENSMUSG00000032549)
Vector Insertion
Chr 9: 103069503 - 103083511
Public Clones E323F06 (ggtc)
Private Clones OST6474 (lexicon)
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000320466 (Chr9:103069436..103069502 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000320466 (Chr9:103069436..103069502 +)
Downstram Exon
ENSMUSE00000478381 (Chr9:103083512..103087598 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTGGGATCATGCCCTAAGAG Chr9:103086302..103086321 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000220692 Chr9:103014281..103014556 CTCCTCCTCCTCCTCCTCCT Chr9:103014443..103014462 61.24 65
upstream ENSMUSE00000320561 Chr9:103042712..103042770 TGACAGCTTCGACAACACCT Chr9:103042746..103042765 59.47 50
upstream ENSMUSE00000320542 Chr9:103063150..103063203 CCATCGGGATTGACTTCTTG Chr9:103063154..103063173 60.45 50
upstream ENSMUSE00000220690 Chr9:103063394..103063499 CCAGCTACATCCGAGACTCC Chr9:103063449..103063468 59.83 60
upstream ENSMUSE00000220691 Chr9:103064872..103064983 AACAAGACGGATCTGGCTGA Chr9:103064958..103064977 60.8 50
upstream ENSMUSE00000220687 Chr9:103066140..103066233 ACTGAGCGTCATGTTCATCG Chr9:103066179..103066198 59.86 50
upstream ENSMUSE00000320466 Chr9:103069436..103069502 No primer for this exon

*** Putative Vector Insertion (Chr 9: 103069503 - 103083511) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000478381 Chr9:103083512..103087598 TTGGGATCATGCCCTAAGAG Chr9:103086302..103086321 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGCTGCTAAAAAGGCATC Chr9:103078462..103078482 59.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTACCTGGGGTCGTGACT Chr9:103078541..103078561 59.45 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032549