Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29184
Trapped Gene
Ccdc77 (ENSMUSG00000030177)
Vector Insertion
Chr 6: 120275052 - 120275512
Public Clones not available
Private Clones OST6464 (lexicon)
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000347606 (Chr6:120275193..120275511 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACAAAGTGGACCTGGAGT Chr6:120275291..120275310 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000347606 (Chr6:120275193..120275511 -)
Downstram Exon
ENSMUSE00000649287 (Chr6:120275053..120275511 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACAAAGTGGACCTGGAGT Chr6:120275291..120275310 60 55 CCCTGAAAGGAGTCATCAGC Chr6:120275325..120275344 59.8 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000290661 Chr6:120307345..120307369 No primer for this exon
upstream ENSMUSE00000692801 Chr6:120307345..120307490 CGTGAGCGATTGGTAGGATT Chr6:120307411..120307430 60.1 50
upstream ENSMUSE00000290655 Chr6:120304019..120304072 GCATGAACTTCACTCCGACA Chr6:120304039..120304058 59.84 50
upstream ENSMUSE00000721759 Chr6:120304019..120304072 GCATGAACTTCACTCCGACA Chr6:120304039..120304058 59.84 50
upstream ENSMUSE00000196098 Chr6:120300225..120300462 CGTTTGCCTCTAAACGTGGT Chr6:120300438..120300457 60.17 50
upstream ENSMUSE00000692800 Chr6:120300225..120300408 GAGAAGCTTGCGAAGAGCAG Chr6:120300225..120300244 60.56 55
upstream ENSMUSE00000196111 Chr6:120298406..120298548 TTGAGTGGAACTTGCAGCAG Chr6:120298522..120298541 60.17 50
upstream ENSMUSE00000196100 Chr6:120291991..120292087 ATAAGGAGCCTCCCCACAGA Chr6:120291991..120292010 60.98 55
upstream ENSMUSE00000196108 Chr6:120289153..120289216 TGAGCCTTCTGCTTCCAAAG Chr6:120289156..120289175 60.65 50
upstream ENSMUSE00000196106 Chr6:120288087..120288178 GACAAGGAGGGCATTTCTGA Chr6:120288124..120288143 60.19 50
upstream ENSMUSE00000196104 Chr6:120284787..120284935 GCTTTCGAGAGAGCAAGTGG Chr6:120284878..120284897 60.28 55
upstream ENSMUSE00000196102 Chr6:120281830..120282049 GCTCTACGAGAGCACCAAGG Chr6:120282009..120282028 60.16 60
upstream ENSMUSE00000196109 Chr6:120279352..120279477 AATTCGGGAGGAAGAAGGAG Chr6:120279372..120279391 59.65 50
upstream ENSMUSE00000196094 Chr6:120279112..120279264 AGAAGGCTTCAAGACGGACA Chr6:120279162..120279181 59.99 50
upstream ENSMUSE00000347606 Chr6:120275193..120275511 CCACAAAGTGGACCTGGAGT Chr6:120275291..120275310 60 55
upstream ENSMUSE00000649287 Chr6:120275053..120275511 CCACAAAGTGGACCTGGAGT Chr6:120275291..120275310 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCCATGCTGTGTGTAATC Chr6:120275456..120275476 60.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCAACCATGAACAACACC Chr6:120275492..120275512 60.82 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030177