Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29189
Trapped Gene
Psme2 (ENSMUSG00000079197)
Vector Insertion
Chr 14: 56209365 - 56209678
Public Clones not available
Private Clones OST6345 (lexicon) OST6340 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000687638 (Chr14:56209679..56209778 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGTGGAGAAGCCCGAAAAC Chr14:56209681..56209700 61.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000687638 (Chr14:56209679..56209778 -)
Downstram Exon
ENSMUSE00000687636 (Chr14:56209332..56209364 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGTGGAGAAGCCCGAAAAC Chr14:56209681..56209700 61.13 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000687638 Chr14:56209679..56209778 GAGTGGAGAAGCCCGAAAAC Chr14:56209681..56209700 61.13 55

*** Putative Vector Insertion (Chr 14: 56209365 - 56209678) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000687636 Chr14:56209332..56209364 No primer for this exon
downstream ENSMUSE00000687631 Chr14:56208870..56208932 ATGATTTTCCGTGGCAAGAA Chr14:56208870..56208889 60.45 40
downstream ENSMUSE00000687627 Chr14:56208456..56208542 TCTGGGATAGGGATGTCCAG Chr14:56208456..56208475 59.88 55
downstream ENSMUSE00000687626 Chr14:56208279..56208348 CTCCTCACCAGGTCTCCATT Chr14:56208274..56208293 59.1 55
downstream ENSMUSE00000687622 Chr14:56208138..56208235 GCTTAACCAAAGCGAGCAAG Chr14:56208151..56208170 60.15 50
downstream ENSMUSE00000687620 Chr14:56207281..56207349 TCCTCAATCTTGGGGATCAG Chr14:56207287..56207306 60 50
downstream ENSMUSE00000687616 Chr14:56207070..56207137 TTGGAAATGGTTGTCTGGAA Chr14:56207048..56207067 58.95 40
downstream ENSMUSE00000687615 Chr14:56206877..56206931 CTACAGCGTCCCCTCGTTCT Chr14:56206881..56206900 61.73 60
downstream ENSMUSE00000687614 Chr14:56206491..56206577 CCCATAGGCTGCTTCATCTC Chr14:56206508..56206527 59.8 55
downstream ENSMUSE00000687613 Chr14:56206281..56206402 TTCGGGTTGACGATTTTCTC Chr14:56206328..56206347 60.05 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGCCAGGAAGGAGTGAGA Chr14:56209644..56209664 59.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCCAGGAAGGAGTGAGA Chr14:56209644..56209664 59.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079197