Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29195
Trapped Gene
Herc1 (ENSMUSG00000038664)
Vector Insertion
Chr 9: 66352701 - 66355945
Public Clones not available
Private Clones OST6156 (lexicon)
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000532426 (Chr9:66352395..66352700 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGGATGCCTGAGATCTGT Chr9:66352483..66352502 60.08 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000532426 (Chr9:66352395..66352700 +)
Downstram Exon
ENSMUSE00000696882 (Chr9:66355946..66356575 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGGATGCCTGAGATCTGT Chr9:66352483..66352502 60.08 55 CAATTGAACGGCAGTTGTTG Chr9:66356069..66356088 60.15 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000421026 Chr9:66198331..66198428 No primer for this exon
upstream ENSMUSE00000696881 Chr9:66198333..66198428 No primer for this exon
upstream ENSMUSE00000373072 Chr9:66219593..66220548 AGAAATGGGTGTCCGAACTG Chr9:66220092..66220111 59.97 50
upstream ENSMUSE00000709541 Chr9:66219593..66220548 AGAAATGGGTGTCCGAACTG Chr9:66220092..66220111 59.97 50
upstream ENSMUSE00000532422 Chr9:66219619..66220548 AGAAATGGGTGTCCGAACTG Chr9:66220092..66220111 59.97 50
upstream ENSMUSE00000696870 Chr9:66219619..66220461 AGAAATGGGTGTCCGAACTG Chr9:66220092..66220111 59.97 50
upstream ENSMUSE00000696867 Chr9:66221423..66221443 No primer for this exon
upstream ENSMUSE00000243541 Chr9:66224124..66224219 TCTGCTGATCGGAGTCAGTG Chr9:66224130..66224149 60.14 55
upstream ENSMUSE00000243517 Chr9:66232800..66232994 GGTGATGCTCCCATTGTTTC Chr9:66232860..66232879 60.33 50
upstream ENSMUSE00000243490 Chr9:66234406..66234717 TTGAGCCTCACCGGTCTATT Chr9:66234536..66234555 59.69 50
upstream ENSMUSE00000497296 Chr9:66235968..66236064 GCTGTCACAGAGGATGGTGA Chr9:66236007..66236026 59.83 55
upstream ENSMUSE00000243438 Chr9:66236562..66236705 TGTGGTCTTTTGGAGGAGGT Chr9:66236679..66236698 59.55 50
upstream ENSMUSE00000503199 Chr9:66239167..66239294 GGAGCCAATCTTCACTTGCT Chr9:66239257..66239276 59.43 50
upstream ENSMUSE00000383369 Chr9:66242467..66242611 CTGCTTTGAGACCCAAGCTC Chr9:66242519..66242538 60.13 55
upstream ENSMUSE00000501424 Chr9:66242735..66242906 AGTTTGGCATGGACTGCTCT Chr9:66242875..66242894 59.87 50
upstream ENSMUSE00000420748 Chr9:66244443..66244577 CATGGCACAGGCCTTATTGT Chr9:66244454..66244473 60.91 50
upstream ENSMUSE00000379523 Chr9:66245060..66245225 AGCTGTGCCTGAAGTTGCTT Chr9:66245080..66245099 60.2 50
upstream ENSMUSE00000365226 Chr9:66245645..66245770 CCCAAGGACCTGATAGATGG Chr9:66245730..66245749 59.36 55
upstream ENSMUSE00000420735 Chr9:66247065..66247286 GTGCATGGGATATGGAAACC Chr9:66247169..66247188 60.02 50
upstream ENSMUSE00000243326 Chr9:66247575..66247727 GATCAAGCATTTGGAGAGCTG Chr9:66247575..66247595 59.97 47.62
upstream ENSMUSE00000243302 Chr9:66247854..66247986 AGTCCTTGGAATGGCAGTGT Chr9:66247950..66247969 59.58 50
upstream ENSMUSE00000243280 Chr9:66250331..66250522 GTGTCAGTGGCTCGTCCTTT Chr9:66250399..66250418 60.31 55
upstream ENSMUSE00000384286 Chr9:66255791..66256012 AAATGGACACCCCTCAGTTG Chr9:66255992..66256011 59.82 50
upstream ENSMUSE00000420717 Chr9:66258823..66258996 AGACTTGGCATTGGGTTGTT Chr9:66258920..66258939 59.45 45
upstream ENSMUSE00000584160 Chr9:66258823..66258863 No primer for this exon
upstream ENSMUSE00000532489 Chr9:66261882..66261996 TTGCAGCACTCCTCAAACAC Chr9:66261942..66261961 60.03 50
upstream ENSMUSE00000635977 Chr9:66261882..66262000 TTGCAGCACTCCTCAAACAC Chr9:66261942..66261961 60.03 50
upstream ENSMUSE00000532488 Chr9:66262086..66262206 CTTGCTTGCAAGAACCTTGA Chr9:66262150..66262169 59.19 45
upstream ENSMUSE00000635976 Chr9:66262093..66262206 CTTGCTTGCAAGAACCTTGA Chr9:66262150..66262169 59.19 45
upstream ENSMUSE00000532487 Chr9:66263991..66264162 AAGAAGAGCGGGAACATGAA Chr9:66264127..66264146 59.81 45
upstream ENSMUSE00000532485 Chr9:66266203..66266515 CGTAGCCGAGACCGAGATAG Chr9:66266241..66266260 59.99 60
upstream ENSMUSE00000532484 Chr9:66266936..66267056 CTGAGAGCCGCCTAGTTCAT Chr9:66266953..66266972 59.6 55
upstream ENSMUSE00000532483 Chr9:66268804..66268855 CCGACGAAATGTTGACTTTGA Chr9:66268809..66268829 61.04 42.86
upstream ENSMUSE00000532482 Chr9:66276618..66276886 CTCTTGGACTCGCCTGAAAC Chr9:66276652..66276671 59.99 55
upstream ENSMUSE00000532481 Chr9:66281083..66281298 CGGGAACCAAAGGAGAGAGT Chr9:66281258..66281277 60.62 55
upstream ENSMUSE00000532480 Chr9:66281531..66281651 GAGAGAGCCCTTCAAGCAAA Chr9:66281618..66281637 59.69 50
upstream ENSMUSE00000532479 Chr9:66281873..66282110 GTGGCCAGTACAAGGTTGCT Chr9:66282067..66282086 60.18 55
upstream ENSMUSE00000532477 Chr9:66282218..66282405 TTGTCTCAAACTGGTGTGCTG Chr9:66282294..66282314 59.93 47.62
upstream ENSMUSE00000532476 Chr9:66285402..66285557 ACAACATGCAGCTGAACTCC Chr9:66285415..66285434 58.88 50
upstream ENSMUSE00000532475 Chr9:66286985..66287091 CGAGGCTTCTTGCTCTTCAC Chr9:66287012..66287031 60.28 55
upstream ENSMUSE00000635970 Chr9:66287603..66287713 TTTTCCCTTCTGTCGGATTG Chr9:66287618..66287637 60.04 45
upstream ENSMUSE00000532469 Chr9:66289710..66289886 AACTCATGGCAGTGGAGGAA Chr9:66289814..66289833 60.66 50
upstream ENSMUSE00000420699 Chr9:66293260..66293499 TCACCGCACTACCTCAGACA Chr9:66293337..66293356 60.46 55
upstream ENSMUSE00000420693 Chr9:66293892..66293975 GAAGATGTGGATGCAGCAGA Chr9:66293910..66293929 59.95 50
upstream ENSMUSE00000361061 Chr9:66295819..66296339 TATCCTTCACCGGACAGACC Chr9:66295932..66295951 59.93 55
upstream ENSMUSE00000219238 Chr9:66298510..66299285 GAGCATCAAGCGACATGAAA Chr9:66298666..66298685 59.96 45
upstream ENSMUSE00000343738 Chr9:66301144..66301342 GAAAGTGACCAAGCACAGCA Chr9:66301164..66301183 60.03 50
upstream ENSMUSE00000242882 Chr9:66303743..66303903 CCAGCCTCTCCTTCTGATGA Chr9:66303819..66303838 60.49 55
upstream ENSMUSE00000242856 Chr9:66305244..66305360 ACTTTCAACGTCCCCTCCTC Chr9:66305266..66305285 60.49 55
upstream ENSMUSE00000242842 Chr9:66306001..66306232 CGACAGTTCTGGGAAGTGGT Chr9:66306124..66306143 60.15 55
upstream ENSMUSE00000242826 Chr9:66308215..66308339 CTGGAAGTGGACCACCAACT Chr9:66308250..66308269 60 55
upstream ENSMUSE00000332324 Chr9:66309507..66309727 CAGGGGCGTTGTATGACTTT Chr9:66309579..66309598 59.99 50
upstream ENSMUSE00000381364 Chr9:66310636..66310904 GGGAAGAAGTGGTCGTGTGT Chr9:66310658..66310677 60.01 55
upstream ENSMUSE00000332837 Chr9:66312513..66312565 CCCAGATCTAATTGGCAAGC Chr9:66312528..66312547 59.67 50
upstream ENSMUSE00000242738 Chr9:66313188..66313388 TGGGAGCATCAGTAGCAATG Chr9:66313326..66313345 59.82 50
upstream ENSMUSE00000242716 Chr9:66314306..66314480 CATGCGAGCACTGTCTCTTC Chr9:66314451..66314470 59.73 55
upstream ENSMUSE00000242696 Chr9:66315190..66315460 CTCAGAACGTTCACGAGGTG Chr9:66315325..66315344 59.46 55
upstream ENSMUSE00000242676 Chr9:66315567..66315780 CAAGCCCTTGTGGCATTATT Chr9:66315702..66315721 59.96 45
upstream ENSMUSE00000412190 Chr9:66316785..66316990 CAACAACTTGTGCGCACTCT Chr9:66316865..66316884 60.1 50
upstream ENSMUSE00000342407 Chr9:66318045..66318172 GCACTATTCGGGTGTGGAAT Chr9:66318103..66318122 59.82 50
upstream ENSMUSE00000635962 Chr9:66319653..66319780 CAGTGGCAAATACCTTGCTG Chr9:66319722..66319741 59.34 50
upstream ENSMUSE00000635961 Chr9:66321190..66321390 GACGGATGGACGGATCTCTA Chr9:66321301..66321320 60.03 55
upstream ENSMUSE00000635960 Chr9:66322541..66322671 CTGCATTGCTTGGTTCAGTG Chr9:66322551..66322570 60.45 50
upstream ENSMUSE00000635958 Chr9:66323728..66323927 TGCCATCCATCCACTGTAAA Chr9:66323848..66323867 59.92 45
upstream ENSMUSE00000635957 Chr9:66324135..66324240 TGTGTTTGGCGTATTCCTCA Chr9:66324157..66324176 60.11 45
upstream ENSMUSE00000635956 Chr9:66326752..66326898 GGACACATCACACCTGTTCG Chr9:66326800..66326819 60.01 55
upstream ENSMUSE00000635955 Chr9:66327238..66327339 ATCGGCTCTGGAGCTATTCA Chr9:66327265..66327284 59.94 50
upstream ENSMUSE00000635954 Chr9:66328669..66328842 CCATGATGCTTCAAGAGCAA Chr9:66328808..66328827 59.95 45
upstream ENSMUSE00000532443 Chr9:66329611..66329904 AGCGCAGTTTCCAGAGTCAT Chr9:66329832..66329851 60.02 50
upstream ENSMUSE00000532442 Chr9:66331464..66331529 GTCTTGGGCAACTTCCAGAC Chr9:66331505..66331524 59.7 55
upstream ENSMUSE00000532441 Chr9:66331685..66331810 GTACCAGCTACAGCGCCTTC Chr9:66331772..66331791 60.04 60
upstream ENSMUSE00000532440 Chr9:66332706..66332844 TATGGCAGATTAGGGCAAGG Chr9:66332778..66332797 60.05 50
upstream ENSMUSE00000532439 Chr9:66333874..66334055 GAGATGGGGACTATGGCAAA Chr9:66333961..66333980 59.89 50
upstream ENSMUSE00000532438 Chr9:66334731..66334886 TTACCTTTGGGAACGGTGAC Chr9:66334783..66334802 59.83 50
upstream ENSMUSE00000532437 Chr9:66335756..66335878 GCCTAGGAAATTCCACAGCA Chr9:66335844..66335863 60.21 50
upstream ENSMUSE00000532436 Chr9:66337137..66337239 TGTCCTCTGTGGAATTGGAA Chr9:66337145..66337164 59.06 45
upstream ENSMUSE00000532435 Chr9:66339765..66339934 GTTTATGCCTGGGGTAGCAA Chr9:66339902..66339921 59.96 50
upstream ENSMUSE00000532434 Chr9:66340963..66341101 AACCACGTTCGAGAACCAAC Chr9:66340981..66341000 60.01 50
upstream ENSMUSE00000532433 Chr9:66343707..66343876 TCATCATGGAGGTTGCTGAA Chr9:66343838..66343857 60.2 45
upstream ENSMUSE00000532432 Chr9:66344976..66345145 CAACTTCGGCCTCTGTTAGC Chr9:66345024..66345043 60.01 55
upstream ENSMUSE00000532430 Chr9:66345396..66345561 TGGAAGGTTAAGCTGGTTGG Chr9:66345484..66345503 60.1 50
upstream ENSMUSE00000532429 Chr9:66346487..66346563 No primer for this exon
upstream ENSMUSE00000532427 Chr9:66348983..66349235 AAGCCTCTGGACCTTCACCT Chr9:66349074..66349093 60.25 55
upstream ENSMUSE00000242257 Chr9:66349737..66349889 TCCCACTCACGTTTTCCAAT Chr9:66349813..66349832 60.35 45
upstream ENSMUSE00000532426 Chr9:66352395..66352700 GTGGGATGCCTGAGATCTGT Chr9:66352483..66352502 60.08 55

*** Putative Vector Insertion (Chr 9: 66352701 - 66355945) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696877 Chr9:66355946..66356582 CAATTGAACGGCAGTTGTTG Chr9:66356069..66356088 60.15 45
downstream ENSMUSE00000696882 Chr9:66355946..66356575 CAATTGAACGGCAGTTGTTG Chr9:66356069..66356088 60.15 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCTGCCAGGTTCTGGTCT Chr9:66355667..66355687 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCTGCCAGGTTCTGGTCT Chr9:66355667..66355687 59.99 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038664