Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29202
Trapped Gene
Dnahc8 (ENSMUSG00000033826)
Vector Insertion
Chr 17: 30970603 - 30977497
Public Clones not available
Private Clones OST6033 (lexicon) OST227 (lexicon) OST159 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000609527 (Chr17:30970501..30970602 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTTCGACAAAAGGCTGCT Chr17:30970567..30970586 59.62 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000609527 (Chr17:30970501..30970602 +)
Downstram Exon
ENSMUSE00000609526 (Chr17:30977498..30977658 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTTCGACAAAAGGCTGCT Chr17:30970567..30970586 59.62 50 GGGATTTTGTAGCCGGTGTA Chr17:30977562..30977581 59.82 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657783 Chr17:30761354..30761585 TGGCGGATGTAGAAGCTACC Chr17:30761453..30761472 60.24 55
upstream ENSMUSE00000346776 Chr17:30772281..30772778 CTCCCTCCAGAAGACACTGC Chr17:30772395..30772414 59.99 60
upstream ENSMUSE00000657782 Chr17:30772887..30773021 GGCCCCTCGCATAAATACAT Chr17:30772929..30772948 61.03 50
upstream ENSMUSE00000657781 Chr17:30780201..30780285 GATCCGTTCACCAGCTTTTT Chr17:30780204..30780223 59.17 45
upstream ENSMUSE00000657780 Chr17:30781502..30781653 CGTCCGTTGTCGTAATGATG Chr17:30781605..30781624 59.99 50
upstream ENSMUSE00000657779 Chr17:30785361..30785550 GTCCAAGCAGGGTGAATCTG Chr17:30785480..30785499 60.66 55
upstream ENSMUSE00000657778 Chr17:30786569..30786732 GGTGCTGATGGTGTGGTACA Chr17:30786699..30786718 60.45 55
upstream ENSMUSE00000657777 Chr17:30790178..30790354 GCTAAATGTCGCACACTCCA Chr17:30790324..30790343 59.87 50
upstream ENSMUSE00000657776 Chr17:30793522..30793635 AATCACCGACTCCGCTAATG Chr17:30793545..30793564 60.1 50
upstream ENSMUSE00000657775 Chr17:30793831..30793938 GCACACGGGATACAGAACCT Chr17:30793840..30793859 60 55
upstream ENSMUSE00000657774 Chr17:30794914..30795015 ATTACTGACGGCGGAACAAA Chr17:30794950..30794969 60.5 45
upstream ENSMUSE00000657773 Chr17:30798931..30799077 CCAGGCATCCTTTCACAAAA Chr17:30798957..30798976 61 45
upstream ENSMUSE00000657772 Chr17:30800243..30800440 GGATCCACGGAGAACAGAAT Chr17:30800374..30800393 58.94 50
upstream ENSMUSE00000657771 Chr17:30805219..30805295 GGCGTTTATGAACAGCACCT Chr17:30805230..30805249 60.14 50
upstream ENSMUSE00000657770 Chr17:30807557..30807656 TTGAACGGATTCTTCAGTGC Chr17:30807607..30807626 58.85 45
upstream ENSMUSE00000657769 Chr17:30809185..30809304 GCCGGATAAATGAACCCATC Chr17:30809273..30809292 61.4 50
upstream ENSMUSE00000657768 Chr17:30810725..30810860 TTGAGGTGGCTTACCACACA Chr17:30810807..30810826 60.15 50
upstream ENSMUSE00000548456 Chr17:30814032..30814219 TTCCGGAACAAGCAAAGAAT Chr17:30814152..30814171 59.69 40
upstream ENSMUSE00000548523 Chr17:30820576..30820656 TGCCTTCTGTGTTCGTCAAC Chr17:30820613..30820632 59.88 50
upstream ENSMUSE00000657767 Chr17:30821076..30821192 CTGACCTGGTCCTCGCTAAT Chr17:30821109..30821128 59.31 55
upstream ENSMUSE00000548519 Chr17:30823328..30823447 ATAGCGGCACCACCAAAGTA Chr17:30823404..30823423 60.52 50
upstream ENSMUSE00000548518 Chr17:30827126..30827261 GAAGCCGTGAAAGAGCTGAT Chr17:30827180..30827199 59.58 50
upstream ENSMUSE00000548517 Chr17:30830894..30831006 GAAGGCCTCGACTTTGAATC Chr17:30830938..30830957 58.86 50
upstream ENSMUSE00000657839 Chr17:30832055..30832161 ACGCGCTTATCTTTGGACAC Chr17:30832115..30832134 60.28 50
upstream ENSMUSE00000548514 Chr17:30837335..30837407 CTGAAGTGCACCTTGCAATC Chr17:30837379..30837398 59.44 50
upstream ENSMUSE00000548513 Chr17:30838790..30838976 GAGGTCAGCAGAGGAGTTGC Chr17:30838853..30838872 60.14 60
upstream ENSMUSE00000548511 Chr17:30841600..30841796 CCCTGCAGGACTTTCAGAAG Chr17:30841735..30841754 59.98 55
upstream ENSMUSE00000548509 Chr17:30843330..30843456 TCCGATCAGAAATCCTCCAC Chr17:30843364..30843383 60.01 50
upstream ENSMUSE00000357731 Chr17:30845236..30845471 CTTATCGATCGAGGCCAAAG Chr17:30845252..30845271 59.8 50
upstream ENSMUSE00000407292 Chr17:30847447..30847551 GAAGCCTACGGCATTTTGAA Chr17:30847447..30847466 60.21 45
upstream ENSMUSE00000358966 Chr17:30849218..30849331 TGCAGCCCAAATTTAAAAGC Chr17:30849246..30849265 60.21 40
upstream ENSMUSE00000409304 Chr17:30849979..30850041 CCAAATATTCCACCCCAAGA Chr17:30849994..30850013 59.62 45
upstream ENSMUSE00000365130 Chr17:30852425..30852525 ATATTCATCCGGGGAGCAAC Chr17:30852460..30852479 61.04 50
upstream ENSMUSE00000394690 Chr17:30854709..30854846 TGAGATCCTCTGGGGAGATG Chr17:30854781..30854800 60.15 55
upstream ENSMUSE00000369492 Chr17:30855772..30856012 ATATCATGGAAGCGCCACTC Chr17:30855969..30855988 60.07 50
upstream ENSMUSE00000332300 Chr17:30857944..30858143 ACCTGAGTTTTGCAGCGTTT Chr17:30858023..30858042 59.92 45
upstream ENSMUSE00000380998 Chr17:30859844..30859997 CCACTTCCTCGGATATCATTG Chr17:30859894..30859914 59.4 47.62
upstream ENSMUSE00000338809 Chr17:30862027..30862190 CCCCATTTACACGAGCAGTT Chr17:30862144..30862163 59.99 50
upstream ENSMUSE00000491845 Chr17:30863731..30863833 No primer for this exon
upstream ENSMUSE00000338312 Chr17:30865108..30865212 ATGAGGTGACCTTCCATGCT Chr17:30865139..30865158 59.53 50
upstream ENSMUSE00000393198 Chr17:30866026..30866187 ATTCGGGCTTTCTCCTCCTA Chr17:30866141..30866160 60.17 50
upstream ENSMUSE00000343731 Chr17:30867959..30868183 ACGCTGATTAGCCAGACGAC Chr17:30868079..30868098 60.43 55
upstream ENSMUSE00000393916 Chr17:30872974..30873146 AATGCACATCAAGTCGGTCA Chr17:30872979..30872998 60.12 45
upstream ENSMUSE00000357757 Chr17:30874196..30874374 GCAGGTGTTTGGGCAAGTAT Chr17:30874294..30874313 60 50
upstream ENSMUSE00000397487 Chr17:30876513..30876700 ATTGCCCGTTTTATCTGTGG Chr17:30876565..30876584 59.82 45
upstream ENSMUSE00000353338 Chr17:30878072..30878158 GTTGCAATGATGGTTCCTGA Chr17:30878132..30878151 59.5 45
upstream ENSMUSE00000395441 Chr17:30878253..30878360 AACTCTGCGAAGAGCAGCTT Chr17:30878332..30878351 59.53 50
upstream ENSMUSE00000351205 Chr17:30879601..30879735 CACGGTCATGAGAGGGCTAC Chr17:30879693..30879712 60.68 60
upstream ENSMUSE00000390212 Chr17:30881459..30881620 ACTTACGCGGAACTGCAATC Chr17:30881531..30881550 60.28 50
upstream ENSMUSE00000357200 Chr17:30883703..30883949 GGATACAGCCACCAACGACT Chr17:30883876..30883895 60 55
upstream ENSMUSE00000403148 Chr17:30884092..30884333 TCCGTGTTGGACGATAACAA Chr17:30884154..30884173 59.96 45
upstream ENSMUSE00000358247 Chr17:30884792..30884932 CCTCCGTCTTCCTGAGTCTG Chr17:30884823..30884842 59.98 60
upstream ENSMUSE00000406257 Chr17:30885453..30885690 GACCACCTCCACAAGCTGTT Chr17:30885513..30885532 60.16 55
upstream ENSMUSE00000372898 Chr17:30888392..30888534 TAGACACGATCGCGAAACAG Chr17:30888509..30888528 60.01 50
upstream ENSMUSE00000406252 Chr17:30888992..30889126 GGTGAAGGCGTACCTGAAGA Chr17:30889036..30889055 60.26 55
upstream ENSMUSE00000371367 Chr17:30889767..30889889 AGGATGGGGAGTACCTACGG Chr17:30889794..30889813 60.2 60
upstream ENSMUSE00000410750 Chr17:30891919..30892132 ATGAGATCGTGCGTCAGATG Chr17:30891926..30891945 59.82 50
upstream ENSMUSE00000375617 Chr17:30893648..30893757 CATGGTTGGGAATTTGGTCT Chr17:30893706..30893725 59.65 45
upstream ENSMUSE00000488030 Chr17:30895190..30895353 AGAAGAGTGCAGCTCGATCC Chr17:30895282..30895301 59.71 55
upstream ENSMUSE00000380572 Chr17:30896515..30896707 CAGCCAATATCCTCCCTGAA Chr17:30896595..30896614 60.03 50
upstream ENSMUSE00000471295 Chr17:30897951..30898073 ACGTCTCTCGACCTGGTGTT Chr17:30898023..30898042 59.76 55
upstream ENSMUSE00000473523 Chr17:30899586..30899716 ATCATTCGAACCTCCTGTGG Chr17:30899595..30899614 59.93 50
upstream ENSMUSE00000373905 Chr17:30902541..30902694 GATGAGGCGTTCCTGGAATA Chr17:30902647..30902666 60.04 50
upstream ENSMUSE00000340172 Chr17:30904744..30904908 AAGGCCTGATATCGGTGATG Chr17:30904787..30904806 59.92 50
upstream ENSMUSE00000363412 Chr17:30906588..30906814 AATCGCTGTGGCCTCATACT Chr17:30906683..30906702 59.72 50
upstream ENSMUSE00000335299 Chr17:30908742..30908860 ACAAGCGGAACGGATGAATA Chr17:30908838..30908857 60.47 45
upstream ENSMUSE00000358979 Chr17:30910474..30910577 ACAGGATCTCGCAGTGAAGG Chr17:30910520..30910539 60.41 55
upstream ENSMUSE00000351734 Chr17:30911891..30912067 GACAGCGAGAAGGTGAAAGC Chr17:30911990..30912009 60.14 55
upstream ENSMUSE00000374360 Chr17:30915952..30916119 AACCAAATGACATTGCCACA Chr17:30915959..30915978 59.82 40
upstream ENSMUSE00000502266 Chr17:30916668..30916883 GGCATCAACAGGGAAGTGTT Chr17:30916854..30916873 59.97 50
upstream ENSMUSE00000390970 Chr17:30919329..30919466 GGCTGAGCTGGATAAAGTGC Chr17:30919412..30919431 59.99 55
upstream ENSMUSE00000357450 Chr17:30921008..30921135 GGTGGACCCAGCAAAGTAAG Chr17:30921093..30921112 59.59 55
upstream ENSMUSE00000402260 Chr17:30921952..30922123 ACTCGTAGGCGATGTTCTGC Chr17:30921952..30921971 60.43 55
upstream ENSMUSE00000342232 Chr17:30924090..30924245 AACGTGGATCAAATCGAAGG Chr17:30924206..30924225 59.93 45
upstream ENSMUSE00000397541 Chr17:30927772..30927927 GGACCCAGCTCTGGATAATG Chr17:30927867..30927886 59.51 55
upstream ENSMUSE00000357375 Chr17:30931578..30931760 TGAAGGGACTCGAGAACCAG Chr17:30931708..30931727 60.38 55
upstream ENSMUSE00000413996 Chr17:30937429..30937534 TATAAGCTGAGCGCCACAAA Chr17:30937513..30937532 59.61 45
upstream ENSMUSE00000657789 Chr17:30940008..30940260 CTGGTGGACGACGAGTCTCT Chr17:30940013..30940032 60.46 60
upstream ENSMUSE00000657788 Chr17:30940938..30941128 AGAGGCCTGTACGAAAACCA Chr17:30941020..30941039 59.73 50
upstream ENSMUSE00000369945 Chr17:30944150..30944271 ACATGACGTGGCTGAACCTT Chr17:30944207..30944226 60.58 50
upstream ENSMUSE00000408854 Chr17:30947205..30947323 TTGATAAAGACGCCCCAGAG Chr17:30947239..30947258 60.21 50
upstream ENSMUSE00000484778 Chr17:30949973..30950175 GGAAGAAAGTGACACGCACA Chr17:30950078..30950097 59.88 50
upstream ENSMUSE00000319532 Chr17:30952577..30952650 No primer for this exon
upstream ENSMUSE00000319112 Chr17:30955005..30955157 AACCACCGAAGACTCCTTCA Chr17:30955085..30955104 59.7 50
upstream ENSMUSE00000319495 Chr17:30956064..30956219 TGGGATCAACCAAGACCTTC Chr17:30956129..30956148 59.9 50
upstream ENSMUSE00000609528 Chr17:30967718..30967834 GGCCAGCGTTCAGTTTATTC Chr17:30967783..30967802 59.71 50
upstream ENSMUSE00000609527 Chr17:30970501..30970602 GACTTCGACAAAAGGCTGCT Chr17:30970567..30970586 59.62 50

*** Putative Vector Insertion (Chr 17: 30970603 - 30977497) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000609526 Chr17:30977498..30977658 GGGATTTTGTAGCCGGTGTA Chr17:30977562..30977581 59.82 50
downstream ENSMUSE00000609525 Chr17:30988573..30988729 TTTCGGTTGAATGTTGGTGA Chr17:30988633..30988652 59.94 40
downstream ENSMUSE00000609524 Chr17:30991746..30991898 ATGATGATCGTCCCTTCGAT Chr17:30991894..30991913 59.32 45
downstream ENSMUSE00000609523 Chr17:30992850..30993039 TAAAGAACCCGGTCATCCAG Chr17:30993033..30993052 59.93 50
downstream ENSMUSE00000609522 Chr17:31008257..31008378 GTGAGCTCGGGTCACTTCTT Chr17:31008300..31008319 59.46 55
downstream ENSMUSE00000609521 Chr17:31011787..31012209 GGAAGCTGCGTGAAGAGAAC Chr17:31011893..31011912 60.14 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGTTTGGGGGAGGAAAAT Chr17:30970609..30970629 60.66 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGTTTGGGGGAGGAAAAT Chr17:30970609..30970629 60.66 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033826