Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29225
Trapped Gene
Krtcap2 (ENSMUSG00000042747)
Vector Insertion
Chr 3: 89053063 - 89053492
Public Clones IST12235H4 (tigm)
Private Clones OST3565 (lexicon)
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000310326 (Chr3:89052996..89053062 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATCCACCGAGTTTGTGTC Chr3:89053035..89053054 59.53 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000310326 (Chr3:89052996..89053062 +)
Downstram Exon
ENSMUSE00000380177 (Chr3:89053493..89053644 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATCCACCGAGTTTGTGTC Chr3:89053035..89053054 59.53 50 TGTTGCCTGGTACAGAGTGG Chr3:89053562..89053581 59.74 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000376450 Chr3:89050182..89050437 GGCGCGTAGAGGAAGAAGTA Chr3:89050312..89050331 59.62 55
upstream ENSMUSE00000310340 Chr3:89050700..89050854 CCTTTTCGTCTTCTCCCTGA Chr3:89050833..89050852 59.4 50
upstream ENSMUSE00000310335 Chr3:89050987..89051050 TGGTAAAGGCTTCCAAGCAA Chr3:89051016..89051035 60.74 45
upstream ENSMUSE00000310326 Chr3:89052996..89053062 TCATCCACCGAGTTTGTGTC Chr3:89053035..89053054 59.53 50

*** Putative Vector Insertion (Chr 3: 89053063 - 89053492) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000380177 Chr3:89053493..89053644 TGTTGCCTGGTACAGAGTGG Chr3:89053562..89053581 59.74 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGCAACAACACCATGTCT Chr3:89053089..89053109 59.45 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGCAACAACACCATGTCT Chr3:89053089..89053109 59.45 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042747