Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29241
Trapped Gene
Acy1 (ENSMUSG00000023262)
Vector Insertion
Chr 9: 106340069 - 106340463
Public Clones IST11504G11 (tigm) IST11504H11 (tigm) IST11534F10 (tigm)
Private Clones OST2165 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000371257 (Chr9:106340464..106340552 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACAGGACTGAGACGTGGAG Chr9:106340472..106340491 59.44 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000371257 (Chr9:106340464..106340552 -)
Downstram Exon
ENSMUSE00000262331 (Chr9:106339960..106340068 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACAGGACTGAGACGTGGAG Chr9:106340472..106340491 59.44 60 AGTGCAGATGCGCAGGTACT Chr9:106339960..106339979 61.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371257 Chr9:106340464..106340552 CACAGGACTGAGACGTGGAG Chr9:106340472..106340491 59.44 60

*** Putative Vector Insertion (Chr 9: 106340069 - 106340463) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000262331 Chr9:106339960..106340068 AGTGCAGATGCGCAGGTACT Chr9:106339960..106339979 61.03 55
downstream ENSMUSE00000262317 Chr9:106339220..106339284 TCTCCTCCAGGAAGGTGATG Chr9:106339236..106339255 60.19 55
downstream ENSMUSE00000262290 Chr9:106339027..106339131 TTTAGCAAGATGGAGGGGAGT Chr9:106339036..106339056 60.08 47.62
downstream ENSMUSE00000262263 Chr9:106338457..106338551 ATGTAGCCCTCGGAATCCTT Chr9:106338477..106338496 59.92 50
downstream ENSMUSE00000262239 Chr9:106338115..106338191 CACAAAGGTCATGTGGATGG Chr9:106338097..106338116 59.81 50
downstream ENSMUSE00000262216 Chr9:106337946..106338035 CAACTCCATCCCCTTGTGAC Chr9:106337979..106337998 60.36 55
downstream ENSMUSE00000262191 Chr9:106337799..106337855 ACCAAGGACTCCGCTCACTA Chr9:106337777..106337796 59.87 55
downstream ENSMUSE00000262170 Chr9:106337427..106337500 ATCCTCAATGAAGCGTGAGG Chr9:106337423..106337442 60.22 50
downstream ENSMUSE00000262140 Chr9:106337296..106337345 GGAATGCCAAGATGGAGCTTA Chr9:106337293..106337313 61.45 47.62
downstream ENSMUSE00000262115 Chr9:106337016..106337160 TCAGATTCACCGAAGTCACG Chr9:106337086..106337105 59.83 50
downstream ENSMUSE00000134181 Chr9:106336861..106336929 CTCAAAGGTGACCCCCTCTC Chr9:106336848..106336867 61.02 60
downstream ENSMUSE00000134180 Chr9:106335898..106335977 AATCATCCGTGGGTGTCATT Chr9:106335919..106335938 60.06 45
downstream ENSMUSE00000134183 Chr9:106335693..106335753 TCTGGCTCCAGAGTGAGGTT Chr9:106335711..106335730 59.99 55
downstream ENSMUSE00000362473 Chr9:106335322..106335576 ATATCCTCATGCAGCCGTTC Chr9:106335469..106335488 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGAGAGCAAGGTTGGAGGA Chr9:106340453..106340473 59.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGAGAGCAAGGTTGGAGGA Chr9:106340453..106340473 59.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023262