Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29248
Trapped Gene
Psmb7 (ENSMUSG00000026750)
Vector Insertion
Chr 2: 38443809 - 38446216
Public Clones not available
Private Clones OST1959 (lexicon)
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000162380 (Chr2:38446217..38446368 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTGGACTTTCTTCGTCCA Chr2:38446246..38446265 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000162380 (Chr2:38446217..38446368 -)
Downstram Exon
ENSMUSE00000253746 (Chr2:38443578..38443808 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTGGACTTTCTTCGTCCA Chr2:38446246..38446265 59.99 50 GTATGCACCCCGAGTCATCT Chr2:38443627..38443646 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394392 Chr2:38499361..38499441 GGTCGGAGGCTTTTCTTTTG Chr2:38499374..38499393 61.09 50
upstream ENSMUSE00000162379 Chr2:38498878..38498971 GCTCGGAAAACTGGCACTAC Chr2:38498900..38498919 59.88 55
upstream ENSMUSE00000162377 Chr2:38497698..38497795 ACTGAAGGGATGGTTGTTGC Chr2:38497743..38497762 59.97 50
upstream ENSMUSE00000162384 Chr2:38495593..38495733 TAATCGGATGCTGAAGCAGA Chr2:38495603..38495622 59.52 45
upstream ENSMUSE00000253774 Chr2:38489371..38489486 CATTGGTGCAGCCCTAGTTT Chr2:38489455..38489474 60.13 50
upstream ENSMUSE00000253762 Chr2:38468952..38469010 GCAATGGCTGTGTTTGAAGA Chr2:38468974..38468993 59.85 45
upstream ENSMUSE00000162380 Chr2:38446217..38446368 AGCTGGACTTTCTTCGTCCA Chr2:38446246..38446265 59.99 50

*** Putative Vector Insertion (Chr 2: 38443809 - 38446216) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000253746 Chr2:38443578..38443808 GTATGCACCCCGAGTCATCT Chr2:38443627..38443646 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000026750