Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29261
Trapped Gene
Cab39l (ENSMUSG00000021981)
Vector Insertion
Chr 14: 60147745 - 60157898
Public Clones not available
Private Clones OST1669 (lexicon)
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000284060 (Chr14:60147679..60147744 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGAAACTGCTGCAATCTGAG Chr14:60147693..60147714 60.71 45.46 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000284060 (Chr14:60147679..60147744 +)
Downstram Exon
ENSMUSE00000494461 (Chr14:60157899..60158042 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGAAACTGCTGCAATCTGAG Chr14:60147693..60147714 60.71 45.46 AGGCTTCGAATTGGATGTTG Chr14:60158031..60158050 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000335307 Chr14:60059823..60059848 No primer for this exon
upstream ENSMUSE00000410236 Chr14:60077923..60078078 CAGACTCCAGATTGGCGATT Chr14:60078016..60078035 60.22 50
upstream ENSMUSE00000284089 Chr14:60080472..60080539 CTGAAAGCTGTAAGCACTGGAA Chr14:60080490..60080511 59.69 45.46
upstream ENSMUSE00000339957 Chr14:60115640..60115781 TGAAAGACAACCTGGCCATT Chr14:60115732..60115751 60.49 45
upstream ENSMUSE00000706496 Chr14:60115671..60115781 TGAAAGACAACCTGGCCATT Chr14:60115732..60115751 60.49 45
upstream ENSMUSE00000122667 Chr14:60118381..60118545 TTCTGTGTGGAACGAACGAC Chr14:60118424..60118443 59.73 50
upstream ENSMUSE00000122665 Chr14:60125102..60125220 CACGGTGTCCTACTGTCGAG Chr14:60125157..60125176 59.33 60
upstream ENSMUSE00000122670 Chr14:60138403..60138571 GCTTCAGATGCCTTCGCTAC Chr14:60138545..60138564 60.12 55
upstream ENSMUSE00000122664 Chr14:60145593..60145652 No primer for this exon
upstream ENSMUSE00000284060 Chr14:60147679..60147744 TGAGAAACTGCTGCAATCTGAG Chr14:60147693..60147714 60.71 45.46

*** Putative Vector Insertion (Chr 14: 60147745 - 60157898) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000494461 Chr14:60157899..60158042 AGGCTTCGAATTGGATGTTG Chr14:60158031..60158050 60.07 45
downstream ENSMUSE00000376253 Chr14:60165823..60166187 AACTGCTCGTCGTCTGTCCT Chr14:60165944..60165963 60.06 55
downstream ENSMUSE00000687235 Chr14:60204341..60204397 CCATCTCTTCAGCCCATGTA Chr14:60204388..60204407 58.67 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTGACCTCTGTTCCCCTTA Chr14:60150742..60150763 59.19 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTGACCTCTGTTCCCCTTA Chr14:60150742..60150763 59.19 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021981