Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29263
Trapped Gene
1600014K23Rik (ENSMUSG00000031708)
Vector Insertion
Chr 8: 86097043 - 86097118
Public Clones not available
Private Clones OST1514 (lexicon)
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212212 (Chr8:86097119..86097222 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACCACAGCCACACTCTAC Chr8:86097155..86097174 59.34 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212212 (Chr8:86097119..86097222 -)
Downstram Exon
ENSMUSE00000212208 (Chr8:86096927..86097042 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACCACAGCCACACTCTAC Chr8:86097155..86097174 59.34 60 ATTTGCGGCCATAAATGAAG Chr8:86096939..86096958 59.93 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681734 Chr8:86118239..86118361 ACTCAGTTGCAGCAGAGCAG Chr8:86118275..86118294 59.52 55
upstream ENSMUSE00000277901 Chr8:86098377..86098427 AAGACGAGGGAGAAGCTGTG Chr8:86098390..86098409 59.6 55
upstream ENSMUSE00000212217 Chr8:86097770..86097821 No primer for this exon
upstream ENSMUSE00000212210 Chr8:86097310..86097354 No primer for this exon
upstream ENSMUSE00000212212 Chr8:86097119..86097222 GCACCACAGCCACACTCTAC Chr8:86097155..86097174 59.34 60

*** Putative Vector Insertion (Chr 8: 86097043 - 86097118) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212208 Chr8:86096927..86097042 ATTTGCGGCCATAAATGAAG Chr8:86096939..86096958 59.93 40
downstream ENSMUSE00000212216 Chr8:86096740..86096845 ATGGTTCCGTGAGAGAATCG Chr8:86096740..86096759 60.07 50
downstream ENSMUSE00000212209 Chr8:86096580..86096652 AGCCCCAATAGTAGGTGCAG Chr8:86096609..86096628 59.22 55
downstream ENSMUSE00000212213 Chr8:86096448..86096491 AGTGCCAGCTTAACCTGCTG Chr8:86096439..86096458 60.59 55
downstream ENSMUSE00000212207 Chr8:86096297..86096354 TGGATGGAGAAGTTCCCAAG Chr8:86096304..86096323 60.04 50
downstream ENSMUSE00000212215 Chr8:86096131..86096219 ACAGGAACAGCCAGGTGAAG Chr8:86096138..86096157 60.3 55
downstream ENSMUSE00000212206 Chr8:86095912..86095957 CTGAGTCAAGATGGCAAAGC Chr8:86095900..86095919 58.6 50
downstream ENSMUSE00000388157 Chr8:86095599..86095834 GTAGTCGCGGAACTCCTTCA Chr8:86095724..86095743 60.4 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCCTTCCCTGGTCTCTGC Chr8:86097087..86097107 60.79 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTCCTTCCCTGGTCTCTGC Chr8:86097087..86097107 60.79 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031708