Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29283
Trapped Gene
Grb10 (ENSMUSG00000020176)
Vector Insertion
Chr 11: 11836809 - 11837003
Public Clones not available
Private Clones OST816 (lexicon)
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000101483 (Chr11:11837004..11837070 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000101483 (Chr11:11837004..11837070 -)
Downstram Exon
ENSMUSE00000101476 (Chr11:11836721..11836808 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000518051 Chr11:11937195..11937404 No primer for this exon
upstream ENSMUSE00000681120 Chr11:11927906..11927974 No primer for this exon
upstream ENSMUSE00000520180 Chr11:11887599..11887677 No primer for this exon
upstream ENSMUSE00000493066 Chr11:11870426..11870645 No primer for this exon
upstream ENSMUSE00000711981 Chr11:11870426..11870645 No primer for this exon
upstream ENSMUSE00000101499 Chr11:11867535..11867688 No primer for this exon
upstream ENSMUSE00000101502 Chr11:11857755..11857829 No primer for this exon
upstream ENSMUSE00000101500 Chr11:11854747..11854911 No primer for this exon
upstream ENSMUSE00000101485 Chr11:11851506..11851662 No primer for this exon
upstream ENSMUSE00000101493 Chr11:11846690..11846805 No primer for this exon
upstream ENSMUSE00000101465 Chr11:11845967..11846035 No primer for this exon
upstream ENSMUSE00000101470 Chr11:11845498..11845635 No primer for this exon
upstream ENSMUSE00000101472 Chr11:11844819..11844929 No primer for this exon
upstream ENSMUSE00000101469 Chr11:11843885..11843983 No primer for this exon
upstream ENSMUSE00000101498 Chr11:11838413..11838487 No primer for this exon
upstream ENSMUSE00000101496 Chr11:11837810..11837926 No primer for this exon
upstream ENSMUSE00000101483 Chr11:11837004..11837070 No primer for this exon

*** Putative Vector Insertion (Chr 11: 11836809 - 11837003) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000101476 Chr11:11836721..11836808 No primer for this exon
downstream ENSMUSE00000101486 Chr11:11834202..11834295 No primer for this exon
downstream ENSMUSE00000706158 Chr11:11833162..11833612 No primer for this exon
downstream ENSMUSE00000681119 Chr11:11833097..11833612 No primer for this exon
downstream ENSMUSE00000101495 Chr11:11830511..11833612 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCCCACTGCATCCTTCTA Chr11:11837014..11837034 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCCCACTGCATCCTTCTA Chr11:11837014..11837034 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020176