Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29291
Trapped Gene
Slc25a20 (ENSMUSG00000032602)
Vector Insertion
Chr 9: 108582536 - 108584302
Public Clones not available
Private Clones OST445 (lexicon)
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000239816 (Chr9:108582418..108582535 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGCTTCTACAAAGGGACTG Chr9:108582498..108582517 59.87 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000239816 (Chr9:108582418..108582535 +)
Downstram Exon
ENSMUSE00000239795 (Chr9:108584303..108584375 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGCTTCTACAAAGGGACTG Chr9:108582498..108582517 59.87 55 TACATCCCACTGGCAGGAAC Chr9:108584327..108584346 60.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000334579 Chr9:108564487..108564663 No primer for this exon
upstream ENSMUSE00000221347 Chr9:108572097..108572189 TGTCTGGACAGCCACCTATG Chr9:108572125..108572144 59.7 55
upstream ENSMUSE00000221346 Chr9:108574750..108574877 TGCTTCTTTGGGTTTGGTCT Chr9:108574816..108574835 59.71 45
upstream ENSMUSE00000221345 Chr9:108579915..108580005 TGGAGAACGGATCAAATGCT Chr9:108579978..108579997 60.6 45
upstream ENSMUSE00000239816 Chr9:108582418..108582535 CGGCTTCTACAAAGGGACTG Chr9:108582498..108582517 59.87 55

*** Putative Vector Insertion (Chr 9: 108582536 - 108584302) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000239795 Chr9:108584303..108584375 TACATCCCACTGGCAGGAAC Chr9:108584327..108584346 60.92 55
downstream ENSMUSE00000239774 Chr9:108584678..108584787 CTGGAATCGAGACTTGAGCA Chr9:108584786..108584805 59.11 50
downstream ENSMUSE00000221349 Chr9:108585380..108585504 TGACTGCATTGAACCCTTTG Chr9:108585481..108585500 59.69 45
downstream ENSMUSE00000239730 Chr9:108586163..108586468 ATGGCAATTTCAAAGCCAAG Chr9:108586194..108586213 60.07 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCACACTCATGCGAGGTA Chr9:108582520..108582540 60.02 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCACACTCATGCGAGGTA Chr9:108582520..108582540 60.02 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032602