Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29301
Trapped Gene
Hmgn1 (ENSMUSG00000040681)
Vector Insertion
Chr 16: 96344025 - 96346329
Public Clones PST17349-NR (escells) PST24284-NR (escells) PST16628-NR (escells) PST23674-NR (escells)
PSTVUpb19a3 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000262291 (Chr16:96346330..96346452 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGGAGAGACGGAAAACCA Chr16:96346331..96346350 59.53 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000262291 (Chr16:96346330..96346452 -)
Downstram Exon
ENSMUSE00000335749 (Chr16:96343196..96344024 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGGAGAGACGGAAAACCA Chr16:96346331..96346350 59.53 45 TCAGTCCCACCAATTCACAA Chr16:96343402..96343421 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486012 Chr16:96349197..96349290 No primer for this exon
upstream ENSMUSE00000401384 Chr16:96349039..96349068 No primer for this exon
upstream ENSMUSE00000348811 Chr16:96348918..96348947 No primer for this exon
upstream ENSMUSE00000389240 Chr16:96348760..96348810 No primer for this exon
upstream ENSMUSE00000262291 Chr16:96346330..96346452 AATGGAGAGACGGAAAACCA Chr16:96346331..96346350 59.53 45

*** Putative Vector Insertion (Chr 16: 96344025 - 96346329) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000335749 Chr16:96343196..96344024 TCAGTCCCACCAATTCACAA Chr16:96343402..96343421 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACGGAAAACCAGGTCAGAA Chr16:96346321..96346341 60.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACGGAAAACCAGGTCAGAA Chr16:96346321..96346341 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTTGGTTGTAATCGCCTTGC Chr16:96346390..96346410 61 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAGCGACGTGACTGGGAAAA Chr16:96346388..96346408 63.63 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040681