Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29305
Trapped Gene
2310008H04Rik (ENSMUSG00000041974)
Vector Insertion
Chr 16: 15889879 - 15895235
Public Clones PSTVUpb21b9 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000280694 (Chr16:15895236..15895289 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGATGTCTGCTGCCTCTGA Chr16:15895243..15895262 60.29 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000280694 (Chr16:15895236..15895289 -)
Downstram Exon
ENSMUSE00000352936 (Chr16:15889320..15889878 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGATGTCTGCTGCCTCTGA Chr16:15895243..15895262 60.29 55 AAGCCCAAGTAGCTGCAAAA Chr16:15889465..15889484 60.02 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459117 Chr16:16146838..16146944 TGCACGTAGGAGATGTCTGG Chr16:16146863..16146882 59.85 55
upstream ENSMUSE00000459097 Chr16:16140801..16140956 TGAGACGGGGAAATTTCAAG Chr16:16140879..16140898 60.04 45
upstream ENSMUSE00000459090 Chr16:16140099..16140165 No primer for this exon
upstream ENSMUSE00000459083 Chr16:16118900..16119076 TGTCCCGAAGACGAAGACAT Chr16:16118905..16118924 60.66 50
upstream ENSMUSE00000459078 Chr16:16114920..16115074 AAGATCCTGGTGGGCCTAGT Chr16:16115013..16115032 59.96 55
upstream ENSMUSE00000704057 Chr16:16073245..16073313 TCCCCCAGGTCTCCTAAAAC Chr16:16073256..16073275 60.3 55
upstream ENSMUSE00000459069 Chr16:16053359..16053609 TCACAAATACCAGGCGGATT Chr16:16053501..16053520 60.33 45
upstream ENSMUSE00000459063 Chr16:16048097..16048197 GGGCTAGCAGAAAGACTCCA Chr16:16048174..16048193 59.57 55
upstream ENSMUSE00000459056 Chr16:16037583..16037802 GACTGCAGACCACTTGATGG Chr16:16037620..16037639 59.26 55
upstream ENSMUSE00000459048 Chr16:15968621..15968810 AACAGTGCGCGAAGACCTAT Chr16:15968713..15968732 59.9 50
upstream ENSMUSE00000459041 Chr16:15966695..15966945 CAAAGAGCTGGCCTATGGTC Chr16:15966806..15966825 59.84 55
upstream ENSMUSE00000382433 Chr16:15936646..15936786 TCTAGTGCAGGATGCCTGTG Chr16:15936758..15936777 60.01 55
upstream ENSMUSE00000280731 Chr16:15915393..15915480 GACACCAGGGCTCTTCAGTT Chr16:15915461..15915480 59.31 55
upstream ENSMUSE00000280729 Chr16:15912762..15912902 CACATCCAACACTGGGACAA Chr16:15912837..15912856 60.42 50
upstream ENSMUSE00000280724 Chr16:15912612..15912671 ACACGTTGCAGCTTCTATGC Chr16:15912637..15912656 59.1 50
upstream ENSMUSE00000280719 Chr16:15904150..15904354 AGAACTTGCCTTGCTGGTGT Chr16:15904189..15904208 59.91 50
upstream ENSMUSE00000280715 Chr16:15903002..15903148 TGAACTGAGTGCCCTCACAC Chr16:15903029..15903048 59.87 55
upstream ENSMUSE00000280709 Chr16:15897317..15897410 GCAATGGGAGACTGGAACAG Chr16:15897331..15897350 60.66 55
upstream ENSMUSE00000280703 Chr16:15895619..15895733 ACTGTTCCCAACTGGTCCTG Chr16:15895694..15895713 60 55
upstream ENSMUSE00000280694 Chr16:15895236..15895289 CTGATGTCTGCTGCCTCTGA Chr16:15895243..15895262 60.29 55

*** Putative Vector Insertion (Chr 16: 15889879 - 15895235) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000352936 Chr16:15889320..15889878 AAGCCCAAGTAGCTGCAAAA Chr16:15889465..15889484 60.02 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGTGTGTAATCGCCTTGC Chr16:15892172..15892192 59.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATCTGTGTGCGTGACTGG Chr16:15895175..15895195 60.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041974