Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29318
Trapped Gene
AC122242.2 (ENSMUSG00000061833)
Vector Insertion
Chr 13: 76092055 - 76092056
Public Clones PSTVUpb14c1 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000553454 (Chr13:76091584..76092054 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAATGGTCACGTTGGTCTTG Chr13:76091982..76092001 60 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000553454 (Chr13:76091584..76092054 +)
Downstram Exon
ENSMUSE00000496113 (Chr13:76092057..76092464 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAATGGTCACGTTGGTCTTG Chr13:76091982..76092001 60 50 TCTGGTGTGGGTTTTCACAA Chr13:76092422..76092441 59.98 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000553454 Chr13:76091584..76092054 CAATGGTCACGTTGGTCTTG Chr13:76091982..76092001 60 50

*** Putative Vector Insertion (Chr 13: 76092055 - 76092056) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000496113 Chr13:76092057..76092464 TCTGGTGTGGGTTTTCACAA Chr13:76092422..76092441 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000061833