Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29319
Trapped Gene
AC153654.4 (ENSMUSG00000066487)
Vector Insertion
Chr 12: 60182381 - 60182554
Public Clones PSTVUpb14c1 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000532055 (Chr12:60182006..60182380 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTGGATCCCTGTCACCAAG Chr12:60182181..60182200 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000532055 (Chr12:60182006..60182380 +)
Downstram Exon
ENSMUSE00000532054 (Chr12:60182555..60182887 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTGGATCCCTGTCACCAAG Chr12:60182181..60182200 59.96 55 GCCTCTGGCTGAAGTGTAGC Chr12:60182692..60182711 60.16 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000532055 Chr12:60182006..60182380 AGTGGATCCCTGTCACCAAG Chr12:60182181..60182200 59.96 55

*** Putative Vector Insertion (Chr 12: 60182381 - 60182554) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000532054 Chr12:60182555..60182887 GCCTCTGGCTGAAGTGTAGC Chr12:60182692..60182711 60.16 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCACGTTGGTCTTGGTGT Chr12:60182409..60182429 60.88 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTCACGTTGGTCTTGGTGT Chr12:60182409..60182429 60.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066487