Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29320
Trapped Gene
BX649621.5 (ENSMUSG00000067946)
Vector Insertion
Chr X: 50252140 - 50252313
Public Clones PSTVUpb14c1 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000554535 (ChrX:50251765..50252139 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGCCCATTAAGGAGTCTG ChrX:50252019..50252038 59.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000554535 (ChrX:50251765..50252139 +)
Downstram Exon
ENSMUSE00000554533 (ChrX:50252314..50252646 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGCCCATTAAGGAGTCTG ChrX:50252019..50252038 59.69 55 CTATACCGGCCATCATCAGG ChrX:50252425..50252444 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000554535 ChrX:50251765..50252139 CCTGCCCATTAAGGAGTCTG ChrX:50252019..50252038 59.69 55

*** Putative Vector Insertion (Chr X: 50252140 - 50252313) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000554533 ChrX:50252314..50252646 CTATACCGGCCATCATCAGG ChrX:50252425..50252444 60.31 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCAAGGCTTTCGTCGCTAT ChrX:50252135..50252155 59.98 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCAAGGCTTTCGTCGCTAT ChrX:50252135..50252155 59.98 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067946