Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29321
Trapped Gene
Cd1d1 (ENSMUSG00000028076)
Vector Insertion
Chr 3: 86801539 - 86801993
Public Clones PSTVUpb6g4 (vanderbilt) PSTVUpb10d11 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000175930 (Chr3:86801994..86802272 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCAAGGGACAAGTGCAACC Chr3:86802076..86802095 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000175930 (Chr3:86801994..86802272 -)
Downstram Exon
ENSMUSE00000297113 (Chr3:86801260..86801538 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCAAGGGACAAGTGCAACC Chr3:86802076..86802095 59.97 50 CATCACCCACACAGGTTTTG Chr3:86801413..86801432 59.85 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000175925 Chr3:86803114..86803259 CGCTATGCGGTACCTACCAT Chr3:86803159..86803178 60 55
upstream ENSMUSE00000673945 Chr3:86803114..86803230 CGCTATGCGGTACCTACCAT Chr3:86803159..86803178 60 55
upstream ENSMUSE00000421134 Chr3:86802669..86802827 GACTCAGCCACCATCAGCTT Chr3:86802689..86802708 60.42 55
upstream ENSMUSE00000175927 Chr3:86802555..86802827 CCAGGGCAAGTTGAGTAACC Chr3:86802654..86802673 59.59 55
upstream ENSMUSE00000175930 Chr3:86801994..86802272 ATCAAGGGACAAGTGCAACC Chr3:86802076..86802095 59.97 50

*** Putative Vector Insertion (Chr 3: 86801539 - 86801993) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000297113 Chr3:86801260..86801538 CATCACCCACACAGGTTTTG Chr3:86801413..86801432 59.85 50
downstream ENSMUSE00000175929 Chr3:86800612..86800708 CTACAGCACCCACCACCACT Chr3:86800615..86800634 61.04 60
downstream ENSMUSE00000567391 Chr3:86800368..86800523 AAAGAGCGTACTGGCTGCTC Chr3:86800350..86800369 59.79 55
downstream ENSMUSE00000175924 Chr3:86799760..86800523 AAAGAGCGTACTGGCTGCTC Chr3:86800350..86800369 59.79 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATTTTCACCCTGGCTCTCC Chr3:86801962..86801982 59.13 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTTCGTGACTGGGAAAAC Chr3:86801927..86801947 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028076