Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29322
Trapped Gene
OTTMUSG00000008822 (ENSMUSG00000073765)
Vector Insertion
Chr 4: 118627292 - 118627401
Public Clones PSTVUpb7h7 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000669602 (Chr4:118627402..118627524 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCATCGCCTGCTCTTCTTTT Chr4:118627417..118627436 60.1 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000669602 (Chr4:118627402..118627524 -)
Downstram Exon
ENSMUSE00000631387 (Chr4:118626878..118627291 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCATCGCCTGCTCTTCTTTT Chr4:118627417..118627436 60.1 45 GCAGGTTCAAAGCTCGTCTC Chr4:118627173..118627192 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669602 Chr4:118627402..118627524 TCATCGCCTGCTCTTCTTTT Chr4:118627417..118627436 60.1 45

*** Putative Vector Insertion (Chr 4: 118627292 - 118627401) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000631387 Chr4:118626878..118627291 GCAGGTTCAAAGCTCGTCTC Chr4:118627173..118627192 60.14 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCGCCTGCTCTTCTTTTC Chr4:118627414..118627434 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCGCCTGCTCTTCTTTTC Chr4:118627414..118627434 60.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000073765