Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29324
Trapped Gene
Spink4 (ENSMUSG00000028415)
Vector Insertion
Chr 4: 40871998 - 40876111
Public Clones PSTVUpb8a12 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000297318 (Chr4:40871957..40871997 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCTTGTTTTCCCCAGAAT Chr4:40871977..40871996 59.94 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000297318 (Chr4:40871957..40871997 +)
Downstram Exon
ENSMUSE00000178965 (Chr4:40876112..40876224 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCTTGTTTTCCCCAGAAT Chr4:40871977..40871996 59.94 45 AGATCAGGTTGGGTGTCTGG Chr4:40876172..40876191 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000297327 Chr4:40867089..40867188 AGCATGGCTATGCATCTGTG Chr4:40867125..40867144 59.85 50
upstream ENSMUSE00000297318 Chr4:40871957..40871997 AGCCTTGTTTTCCCCAGAAT Chr4:40871977..40871996 59.94 45

*** Putative Vector Insertion (Chr 4: 40871998 - 40876111) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000178965 Chr4:40876112..40876224 AGATCAGGTTGGGTGTCTGG Chr4:40876172..40876191 59.96 55
downstream ENSMUSE00000403518 Chr4:40878290..40878427 CTCTGGGGCATCACTGTTCT Chr4:40878396..40878415 60.26 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACATCTGCTAATCGCCTTGC Chr4:40875041..40875061 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGGACATCTGCCGTGACTG Chr4:40872037..40872057 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028415