Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29325
Trapped Gene
5730427N09Rik (ENSMUSG00000060739)
Vector Insertion
Chr 13: 97901184 - 97901797
Public Clones PSTVUpb7a11 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000483452 (Chr13:97901798..97901990 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTTGCCTGCCTATTCTCG Chr13:97901921..97901940 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000483452 (Chr13:97901798..97901990 -)
Downstram Exon
ENSMUSE00000640443 (Chr13:97900953..97901183 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTTGCCTGCCTATTCTCG Chr13:97901921..97901940 59.97 50 TGCTTGATGACTGCACATGA Chr13:97900970..97900989 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680299 Chr13:97907710..97907821 GTGGACCAGTGACATCCAGA Chr13:97907770..97907789 59.5 55
upstream ENSMUSE00000484448 Chr13:97905476..97905663 GCCATGCCGAGAAAATACAA Chr13:97905487..97905506 60.97 45
upstream ENSMUSE00000489199 Chr13:97905249..97905399 GAGCAGTCCCTGCCTATCTG Chr13:97905321..97905340 59.97 60
upstream ENSMUSE00000680298 Chr13:97903580..97903673 GGAGGTCCCTCTACCCAAAG Chr13:97903646..97903665 59.93 60
upstream ENSMUSE00000486116 Chr13:97903494..97903673 GGCGATGGCTTTACAAGAAA Chr13:97903528..97903547 60.21 45
upstream ENSMUSE00000680297 Chr13:97903111..97903130 No primer for this exon
upstream ENSMUSE00000483452 Chr13:97901798..97901990 CTTTTGCCTGCCTATTCTCG Chr13:97901921..97901940 59.97 50

*** Putative Vector Insertion (Chr 13: 97901184 - 97901797) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000640443 Chr13:97900953..97901183 TGCTTGATGACTGCACATGA Chr13:97900970..97900989 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000060739