Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29327
Trapped Gene
Pank2 (ENSMUSG00000037514)
Vector Insertion
Chr 2: 131122008 - 131122060
Public Clones E13 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000254964 (Chr2:131122009..131122427 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTCTAAGGACACCCCATCC Chr2:131122218..131122237 59.78 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000254964 (Chr2:131122009..131122427 +)
Downstram Exon
ENSMUSE00000706239 (Chr2:131122009..131122059 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTCTAAGGACACCCCATCC Chr2:131122218..131122237 59.78 55 TCAACAGCTCGAGGAGTGCT Chr2:131122051..131122070 61.3 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000404223 Chr2:131088236..131088551 GGAGGCGGAGAGTGTGAGAC Chr2:131088454..131088473 62.38 65
upstream ENSMUSE00000683071 Chr2:131098917..131098940 No primer for this exon
upstream ENSMUSE00000254991 Chr2:131099647..131099999 CTTACGGATCCACAGGCATT Chr2:131099788..131099807 59.96 50
upstream ENSMUSE00000640893 Chr2:131099647..131099715 GGTTTGGCTTGGATATTGGA Chr2:131099656..131099675 59.76 45
upstream ENSMUSE00000640892 Chr2:131099721..131099999 CTTACGGATCCACAGGCATT Chr2:131099788..131099807 59.96 50
upstream ENSMUSE00000254985 Chr2:131105893..131106146 GGCTCAGGGGTTAGCATCTT Chr2:131106082..131106101 60.6 55
upstream ENSMUSE00000558513 Chr2:131108328..131108504 No primer for this exon
upstream ENSMUSE00000254975 Chr2:131113210..131113333 ACCAACAACATTGGCTCCAT Chr2:131113289..131113308 60.24 45
upstream ENSMUSE00000254969 Chr2:131119135..131119260 AAGCACTGTTTTCCGAGCAC Chr2:131119238..131119257 60.44 50

*** Putative Vector Insertion (Chr 2: 131122008 - 131122060) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000254964 Chr2:131122009..131122427 GGTTAATAACGCTGCCCTGA Chr2:131122306..131122325 60.1 50
downstream ENSMUSE00000706239 Chr2:131122009..131122059 TCAACAGCTCGAGGAGTGCT Chr2:131122051..131122070 61.3 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACTCCTCGAGCTGTTGAAG Chr2:131122032..131122052 58.75 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAGATACCCTCGTGACTGG Chr2:131122047..131122068 60.12 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037514