Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29342
Trapped Gene
Arhgef1 (ENSMUSG00000040940)
Vector Insertion
Chr 7: 25704796 - 25706889
Public Clones PSTVU01.HE8Q (vanderbilt) IST14406G11 (tigm) IST14405A1 (tigm) IST11814E7 (tigm)
IST12058F7 (tigm) IST12267F3 (tigm) IST13248H7 (tigm) IST14280C1 (tigm)
IST13136H10 (tigm) IST14312E6 (tigm) IST12654G1 (tigm) IST13978F2 (tigm)
IST13795F1 (tigm) IST12314B9 (tigm) IST14379C6 (tigm) IST11814E7 (tigm)
IST11189B8 (tigm) IST14854B11 (tigm) IST13890C10 (tigm) IST10513B2 (tigm)
IST12053F12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000316725 (Chr7:25704650..25704795 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGACACCCTGCTCAGTCT Chr7:25704738..25704757 60.46 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000316725 (Chr7:25704650..25704795 +)
Downstram Exon
ENSMUSE00000316718 (Chr7:25706890..25707036 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGACACCCTGCTCAGTCT Chr7:25704738..25704757 60.46 60 GTCATGCAGTACCCGTAGCA Chr7:25706945..25706964 59.75 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711973 Chr7:25687931..25688147 No primer for this exon
upstream ENSMUSE00000676693 Chr7:25688056..25688147 No primer for this exon
upstream ENSMUSE00000676703 Chr7:25689424..25689516 CTTCTCTTCCCATCCGACAG Chr7:25689497..25689516 59.8 55
upstream ENSMUSE00000716760 Chr7:25689426..25689516 CTTCTCTTCCCATCCGACAG Chr7:25689497..25689516 59.8 55
upstream ENSMUSE00000535991 Chr7:25692735..25692776 TCCTGGAGATGGGAGAAGTC Chr7:25692745..25692764 59.18 55
upstream ENSMUSE00000713033 Chr7:25692735..25692776 TCCTGGAGATGGGAGAAGTC Chr7:25692745..25692764 59.18 55
upstream ENSMUSE00000316794 Chr7:25692873..25692953 GATTTTGAGAACGAGCTGGAG Chr7:25692930..25692950 59.07 47.62
upstream ENSMUSE00000316790 Chr7:25693330..25693443 GCCAGTTCCAGAGCCTAGAG Chr7:25693349..25693368 59.19 60
upstream ENSMUSE00000316781 Chr7:25697076..25697174 No primer for this exon
upstream ENSMUSE00000316777 Chr7:25697329..25697371 CCCAGTGTCGCTTTTGAACT Chr7:25697350..25697369 60.29 50
upstream ENSMUSE00000316770 Chr7:25697574..25697820 GAGGCGGTTCATACAAGAGG Chr7:25697611..25697630 59.69 55
upstream ENSMUSE00000316763 Chr7:25698159..25698188 No primer for this exon
upstream ENSMUSE00000316759 Chr7:25698418..25698517 GACCAAGAGTGGGGACAAGA Chr7:25698469..25698488 60.09 55
upstream ENSMUSE00000316751 Chr7:25698639..25698735 GAATCGGAGGTCAGACGAAC Chr7:25698647..25698666 59.66 55
upstream ENSMUSE00000316744 Chr7:25701037..25701072 No primer for this exon
upstream ENSMUSE00000316738 Chr7:25701820..25701960 GGGTATGTCTTCTCGGGACA Chr7:25701857..25701876 59.93 55
upstream ENSMUSE00000636501 Chr7:25701823..25701960 GGGTATGTCTTCTCGGGACA Chr7:25701857..25701876 59.93 55
upstream ENSMUSE00000316731 Chr7:25702914..25703019 AGGACAATGGCGAGACTGAG Chr7:25702998..25703017 60.41 55
upstream ENSMUSE00000636500 Chr7:25703539..25703550 No primer for this exon
upstream ENSMUSE00000636499 Chr7:25704203..25704370 No primer for this exon
upstream ENSMUSE00000316725 Chr7:25704650..25704795 CCAGACACCCTGCTCAGTCT Chr7:25704738..25704757 60.46 60

*** Putative Vector Insertion (Chr 7: 25704796 - 25706889) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000316718 Chr7:25706890..25707036 GTCATGCAGTACCCGTAGCA Chr7:25706945..25706964 59.75 55
downstream ENSMUSE00000316709 Chr7:25707344..25707426 ATCAAGCGATCGAGGAACAG Chr7:25707368..25707387 60.36 50
downstream ENSMUSE00000316700 Chr7:25707560..25707685 No primer for this exon
downstream ENSMUSE00000316692 Chr7:25707826..25707940 AGCAGCAGTGGGTACTTGGT Chr7:25707920..25707939 59.79 55
downstream ENSMUSE00000316681 Chr7:25708029..25708129 TCCACTTTCCCTCGTTCTGT Chr7:25708059..25708078 59.7 50
downstream ENSMUSE00000316670 Chr7:25708383..25708460 GCCGTAGGTGAGTCAAGTCC Chr7:25708431..25708450 59.73 60
downstream ENSMUSE00000316663 Chr7:25708678..25708753 No primer for this exon
downstream ENSMUSE00000316655 Chr7:25708822..25708989 No primer for this exon
downstream ENSMUSE00000316647 Chr7:25709815..25709902 TTTTTGCGTTCCGAAGATGT Chr7:25709905..25709924 60.62 40
downstream ENSMUSE00000316638 Chr7:25709995..25710081 TTCAGGGATCCAGCAGTCTC Chr7:25710036..25710055 60.35 55
downstream ENSMUSE00000316630 Chr7:25710271..25710338 CATCAGCTGGAGCCATCTCT Chr7:25710341..25710360 60.52 55
downstream ENSMUSE00000316622 Chr7:25710420..25710506 CAGAAGGGCAGGAGGTCATT Chr7:25710462..25710481 61.55 55
downstream ENSMUSE00000316615 Chr7:25710803..25710966 AGTTGTCTGATGGCCACCTC Chr7:25710965..25710984 60.12 55
downstream ENSMUSE00000354389 Chr7:25711043..25711142 GGGGTCTTAGGCGACAAAAT Chr7:25711079..25711098 60.32 50
downstream ENSMUSE00000676689 Chr7:25711043..25711142 GGGGTCTTAGGCGACAAAAT Chr7:25711079..25711098 60.32 50
downstream ENSMUSE00000676687 Chr7:25711259..25711604 GTTCAGCCAATCTCCCTCTG Chr7:25711376..25711395 59.8 55
downstream ENSMUSE00000676692 Chr7:25711259..25711604 GTTCAGCCAATCTCCCTCTG Chr7:25711376..25711395 59.8 55
downstream ENSMUSE00000720406 Chr7:25711259..25711611 GTTCAGCCAATCTCCCTCTG Chr7:25711376..25711395 59.8 55
downstream ENSMUSE00000676694 Chr7:25711329..25711371 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCGGTGAGTGCTACTCTG Chr7:25704792..25704812 59.79 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCGGTGAGTGCTACTCTG Chr7:25704792..25704812 59.79 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040940