Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29343
Trapped Gene
Rbm42 (ENSMUSG00000036733)
Vector Insertion
Chr 7: 31426326 - 31429636
Public Clones PSTVU01.HE33T (vanderbilt) PSTVU01.E401 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000242772 (Chr7:31429518..31429635 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCACTGGGTGAAGACAAG Chr7:31429609..31429628 60.3 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000242772 (Chr7:31429518..31429635 -)
Downstram Exon
ENSMUSE00000242765 (Chr7:31426327..31426521 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCACTGGGTGAAGACAAG Chr7:31429609..31429628 60.3 55 GTTCACCTCATTGCCCAGAT Chr7:31426456..31426475 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000242812 Chr7:31434957..31435184 AAAGAAATGGAGGCGGAGAT Chr7:31434963..31434982 60.04 45
upstream ENSMUSE00000675741 Chr7:31434957..31435163 AAAGAAATGGAGGCGGAGAT Chr7:31434963..31434982 60.04 45
upstream ENSMUSE00000675743 Chr7:31434957..31435336 AAAGAAATGGAGGCGGAGAT Chr7:31434963..31434982 60.04 45
upstream ENSMUSE00000242805 Chr7:31434603..31434738 CTGTGATCCGCCCAATTATC Chr7:31434624..31434643 60.3 50
upstream ENSMUSE00000242800 Chr7:31432750..31432834 TGCAGCCACAGTTGTTCCTC Chr7:31432783..31432802 62.43 55
upstream ENSMUSE00000242796 Chr7:31432579..31432653 ATCGTGGTCACCTGGACAGT Chr7:31432616..31432635 60.44 55
upstream ENSMUSE00000242791 Chr7:31430938..31431003 CCACGTGCTACAGAGAGCAG Chr7:31430938..31430957 59.79 60
upstream ENSMUSE00000242784 Chr7:31430686..31430861 GGGTTCTATGGCTGCTCTGA Chr7:31430697..31430716 60.36 55
upstream ENSMUSE00000675740 Chr7:31430686..31430840 GGGTTCTATGGCTGCTCTGA Chr7:31430697..31430716 60.36 55
upstream ENSMUSE00000242778 Chr7:31429845..31430177 GCTCTTGTCTCTCCGTCCAC Chr7:31429895..31429914 59.99 60
upstream ENSMUSE00000242772 Chr7:31429518..31429635 AGCCACTGGGTGAAGACAAG Chr7:31429609..31429628 60.3 55
upstream ENSMUSE00000242765 Chr7:31426327..31426521 AAGGCTAAGGTGATCCGTGA Chr7:31426413..31426432 59.69 50

*** Putative Vector Insertion (Chr 7: 31426326 - 31429636) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000675744 Chr7:31426021..31426239 ATGCTTTTGCGAAGCTTGAT Chr7:31426175..31426194 59.99 40
downstream ENSMUSE00000412401 Chr7:31426018..31426239 ATGCTTTTGCGAAGCTTGAT Chr7:31426175..31426194 59.99 40
downstream ENSMUSE00000675742 Chr7:31426013..31426239 ATGCTTTTGCGAAGCTTGAT Chr7:31426175..31426194 59.99 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCTAGAGAGTCCCAGAGG Chr7:31426656..31426676 60.35 65 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAACCGTGACTGGGAAAACC Chr7:31426569..31426589 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036733