Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29362
Trapped Gene
C230081A13Rik (ENSMUSG00000074305)
Vector Insertion
Chr 9: 56108570 - 56166469
Public Clones Ayu21-T78 (egtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698692 (Chr9:56166470..56166627 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAAACTACCTTGCTCACC Chr9:56166500..56166519 59.74 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698692 (Chr9:56166470..56166627 -)
Downstram Exon
ENSMUSE00000384049 (Chr9:56105334..56108569 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAAACTACCTTGCTCACC Chr9:56166500..56166519 59.74 55 CTCTGAACGCTTCCTTGACC Chr9:56107421..56107440 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698694 Chr9:56265748..56265874 CAATGCTGAATATCGCAACG Chr9:56265765..56265784 60.24 45
upstream ENSMUSE00000698693 Chr9:56222183..56222246 CCCAGGACTTATGCGCTAGA Chr9:56222215..56222234 60.37 55
upstream ENSMUSE00000698692 Chr9:56166470..56166627 GCCAAACTACCTTGCTCACC Chr9:56166500..56166519 59.74 55

*** Putative Vector Insertion (Chr 9: 56108570 - 56166469) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000384049 Chr9:56105334..56108569 CTCTGAACGCTTCCTTGACC Chr9:56107421..56107440 59.99 55
downstream ENSMUSE00000352103 Chr9:56088967..56089151 TGACTGAAGTGCCATCTTGC Chr9:56089047..56089066 59.99 50
downstream ENSMUSE00000430897 Chr9:56074909..56075651 TAGCCATGACGCAAAGACTG Chr9:56075411..56075430 60.01 50
downstream ENSMUSE00000385855 Chr9:56052936..56055418 CAGGGAAGCAGACGACTAGG Chr9:56055260..56055279 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACCATCTGGCTGTTCACAA Chr9:56145460..56145480 59.14 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTGTGATCTCCCCGTGACT Chr9:56145411..56145432 60.76 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074305