Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29374
Trapped Gene
Foxj2 (ENSMUSG00000003154)
Vector Insertion
Chr 6: 122770989 - 122778174
Public Clones Ayu21-B101 (egtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000452488 (Chr6:122770710..122770988 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000452488 (Chr6:122770710..122770988 +)
Downstram Exon
ENSMUSE00000334179 (Chr6:122778175..122778521 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692293 Chr6:122770529..122770687 No primer for this exon
upstream ENSMUSE00000452488 Chr6:122770710..122770988 No primer for this exon
upstream ENSMUSE00000692292 Chr6:122770731..122770988 No primer for this exon

*** Putative Vector Insertion (Chr 6: 122770989 - 122778174) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000334179 Chr6:122778175..122778521 No primer for this exon
downstream ENSMUSE00000197518 Chr6:122781454..122781528 No primer for this exon
downstream ENSMUSE00000197520 Chr6:122782956..122783024 No primer for this exon
downstream ENSMUSE00000197516 Chr6:122783179..122783319 No primer for this exon
downstream ENSMUSE00000197519 Chr6:122783699..122783894 No primer for this exon
downstream ENSMUSE00000197525 Chr6:122787839..122788222 No primer for this exon
downstream ENSMUSE00000283359 Chr6:122788602..122788703 No primer for this exon
downstream ENSMUSE00000283351 Chr6:122789479..122789688 No primer for this exon
downstream ENSMUSE00000197523 Chr6:122790244..122790342 No primer for this exon
downstream ENSMUSE00000381256 Chr6:122792782..122795359 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTGTTAGTTTTGGCATGA Chr6:122773983..122774003 58.77 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTCGTGACTGGGAAAACC Chr6:122774036..122774056 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003154