Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29378
Trapped Gene
Bptf (ENSMUSG00000040481)
Vector Insertion
Chr 11: 106939964 - 106942036
Public Clones Ayu18-44 (egtc)
Private Clones not available
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000396339 (Chr11:106942037..106942168 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATCAAGGCCGTTCAGATGT Chr11:106942140..106942159 60.08 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000396339 (Chr11:106942037..106942168 -)
Downstram Exon
ENSMUSE00000711588 (Chr11:106939834..106939963 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATCAAGGCCGTTCAGATGT Chr11:106942140..106942159 60.08 50 TGGTGCTTCACTGGAAATGT Chr11:106939813..106939832 59.14 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486355 Chr11:106992588..106993441 GATGACCACGAGAGTGACGA Chr11:106992809..106992828 59.83 55
upstream ENSMUSE00000714292 Chr11:106992588..106993441 GATGACCACGAGAGTGACGA Chr11:106992809..106992828 59.83 55
upstream ENSMUSE00000108627 Chr11:106972127..106972949 AGGTTGTCCCCTTTTTGCTT Chr11:106972763..106972782 59.98 45
upstream ENSMUSE00000108626 Chr11:106960880..106961103 GGAAGACCTGACCAACAAGG Chr11:106960919..106960938 59.55 55
upstream ENSMUSE00000108629 Chr11:106957030..106957239 AGCTCCAAGGATGCTGAGAA Chr11:106957119..106957138 60.1 50
upstream ENSMUSE00000576188 Chr11:106956316..106956504 TTGGCGACAACACAACAAAT Chr11:106956440..106956459 60.01 40
upstream ENSMUSE00000671086 Chr11:106948026..106948211 TAGTGCTACCACTGCCTCCA Chr11:106948158..106948177 59.47 55
upstream ENSMUSE00000108620 Chr11:106943827..106944014 TGGGTCCACTCGTATCATCA Chr11:106943928..106943947 59.92 50
upstream ENSMUSE00000364449 Chr11:106942530..106942885 ACGGGTCCAAAGTCCTTACC Chr11:106942613..106942632 60.22 55
upstream ENSMUSE00000396339 Chr11:106942037..106942168 GATCAAGGCCGTTCAGATGT Chr11:106942140..106942159 60.08 50

*** Putative Vector Insertion (Chr 11: 106939964 - 106942036) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000711588 Chr11:106939834..106939963 TGGTGCTTCACTGGAAATGT Chr11:106939813..106939832 59.14 45
downstream ENSMUSE00000712453 Chr11:106939834..106939963 TGGTGCTTCACTGGAAATGT Chr11:106939813..106939832 59.14 45
downstream ENSMUSE00000671053 Chr11:106938974..106939082 AACGTGCGTCTTGCTAATCC Chr11:106939016..106939035 60.28 50
downstream ENSMUSE00000671081 Chr11:106938974..106939082 AACGTGCGTCTTGCTAATCC Chr11:106939016..106939035 60.28 50
downstream ENSMUSE00000671052 Chr11:106937836..106938015 TGGACTTCGTGGACTTTTCC Chr11:106937932..106937951 60.09 50
downstream ENSMUSE00000671080 Chr11:106937836..106938015 TGGACTTCGTGGACTTTTCC Chr11:106937932..106937951 60.09 50
downstream ENSMUSE00000646795 Chr11:106933997..106934047 CCAAAGGTCGGTCTAGGAGA Chr11:106933987..106934006 59.28 55
downstream ENSMUSE00000671050 Chr11:106933997..106936304 GTGCTGCTATCGTCCTGTGA Chr11:106935544..106935563 60.02 55
downstream ENSMUSE00000671079 Chr11:106933997..106936304 GTGCTGCTATCGTCCTGTGA Chr11:106935544..106935563 60.02 55
downstream ENSMUSE00000671078 Chr11:106929589..106929713 TGTCCGTGTAGACCCTCCTC Chr11:106929568..106929587 60.11 60
downstream ENSMUSE00000710104 Chr11:106929589..106929713 TGTCCGTGTAGACCCTCCTC Chr11:106929568..106929587 60.11 60
downstream ENSMUSE00000719142 Chr11:106929589..106929713 TGTCCGTGTAGACCCTCCTC Chr11:106929568..106929587 60.11 60
downstream ENSMUSE00000352211 Chr11:106928441..106928569 CCCACATCACGCCTCTTAAT Chr11:106928493..106928512 59.96 50
downstream ENSMUSE00000671048 Chr11:106928441..106928569 CCCACATCACGCCTCTTAAT Chr11:106928493..106928512 59.96 50
downstream ENSMUSE00000390684 Chr11:106927260..106927410 CTCAGCAAAAGCCCTGATCT Chr11:106927240..106927259 59.57 50
downstream ENSMUSE00000671046 Chr11:106927260..106927410 CTCAGCAAAAGCCCTGATCT Chr11:106927240..106927259 59.57 50
downstream ENSMUSE00000344737 Chr11:106926982..106927024 CTGCTGCTTGAGCCTTTTCT Chr11:106926974..106926993 59.9 50
downstream ENSMUSE00000671045 Chr11:106926982..106927024 CTGCTGCTTGAGCCTTTTCT Chr11:106926974..106926993 59.9 50
downstream ENSMUSE00000404413 Chr11:106923850..106924096 CACGTGGCAAAAGTTTGATG Chr11:106923854..106923873 60.15 45
downstream ENSMUSE00000671044 Chr11:106923850..106924096 CACGTGGCAAAAGTTTGATG Chr11:106923854..106923873 60.15 45
downstream ENSMUSE00000671067 Chr11:106923364..106923525 CCCGTAATTTGGAACGTCTG Chr11:106923437..106923456 60.36 50
downstream ENSMUSE00000358525 Chr11:106922998..106923149 CCTGGGCTGGAATGAAGTAA Chr11:106923039..106923058 60.07 50
downstream ENSMUSE00000671043 Chr11:106922998..106923149 CCTGGGCTGGAATGAAGTAA Chr11:106923039..106923058 60.07 50
downstream ENSMUSE00000671041 Chr11:106921786..106921894 GTGTTCGAATGATCGCCTTT Chr11:106921782..106921801 60.08 45
downstream ENSMUSE00000714899 Chr11:106921786..106921894 GTGTTCGAATGATCGCCTTT Chr11:106921782..106921801 60.08 45
downstream ENSMUSE00000720302 Chr11:106921786..106921894 GTGTTCGAATGATCGCCTTT Chr11:106921782..106921801 60.08 45
downstream ENSMUSE00000353016 Chr11:106919948..106920165 TCACAACTTGTTGGGGTGTG Chr11:106920123..106920142 60.45 50
downstream ENSMUSE00000671066 Chr11:106919948..106920165 TCACAACTTGTTGGGGTGTG Chr11:106920123..106920142 60.45 50
downstream ENSMUSE00000393473 Chr11:106917186..106917420 CCAGTAGTCTGCCCTTGTCC Chr11:106917346..106917365 59.72 60
downstream ENSMUSE00000671065 Chr11:106917186..106917420 CCAGTAGTCTGCCCTTGTCC Chr11:106917346..106917365 59.72 60
downstream ENSMUSE00000490446 Chr11:106915770..106916632 AATTGGAATCGGCTGTGAAG Chr11:106916204..106916223 60.07 45
downstream ENSMUSE00000671064 Chr11:106915770..106916632 AATTGGAATCGGCTGTGAAG Chr11:106916204..106916223 60.07 45
downstream ENSMUSE00000324110 Chr11:106914537..106914619 CTCTTTCAGCTGGAGTCATGG Chr11:106914528..106914548 60 52.38
downstream ENSMUSE00000671063 Chr11:106914537..106914619 CTCTTTCAGCTGGAGTCATGG Chr11:106914528..106914548 60 52.38
downstream ENSMUSE00000324100 Chr11:106914103..106914328 GAGCGCTCTCTTTCTCAGGA Chr11:106914111..106914130 59.97 55
downstream ENSMUSE00000671062 Chr11:106914103..106914328 GAGCGCTCTCTTTCTCAGGA Chr11:106914111..106914130 59.97 55
downstream ENSMUSE00000324091 Chr11:106908314..106908657 CATCGTACGGTGTCTTGCAG Chr11:106908299..106908318 60.32 55
downstream ENSMUSE00000671061 Chr11:106908314..106908657 CATCGTACGGTGTCTTGCAG Chr11:106908299..106908318 60.32 55
downstream ENSMUSE00000324085 Chr11:106904947..106905139 CCCGTGGTACCAATTCTGAC Chr11:106905075..106905094 60.23 55
downstream ENSMUSE00000671059 Chr11:106904947..106905139 CCCGTGGTACCAATTCTGAC Chr11:106905075..106905094 60.23 55
downstream ENSMUSE00000324075 Chr11:106903989..106904073 GGTGCATCATTGGGGTCTAC Chr11:106903999..106904018 60.2 55
downstream ENSMUSE00000671058 Chr11:106903989..106904073 GGTGCATCATTGGGGTCTAC Chr11:106903999..106904018 60.2 55
downstream ENSMUSE00000324067 Chr11:106901540..106901726 TGGTCATATCTGCCACGAAC Chr11:106901630..106901649 59.53 50
downstream ENSMUSE00000671056 Chr11:106901540..106901726 TGGTCATATCTGCCACGAAC Chr11:106901630..106901649 59.53 50
downstream ENSMUSE00000576190 Chr11:106896860..106897153 CTTTTCCTTTGTCCGTTGGA Chr11:106896917..106896936 60.08 45
downstream ENSMUSE00000671040 Chr11:106894397..106897153 AAAAGCCTTACCGCCGTTAT Chr11:106894584..106894603 59.99 45
downstream ENSMUSE00000671069 Chr11:106894397..106897153 AAAAGCCTTACCGCCGTTAT Chr11:106894584..106894603 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGGTGAGTAAATCCTGAGC Chr11:106942018..106942038 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGGTGAGTAAATCCTGAGC Chr11:106942018..106942038 59.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040481