Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29383
Trapped Gene
Slc7a2 (ENSMUSG00000031596)
Vector Insertion
Chr 8: 41947912 - 41960301
Public Clones (egtc) Ayu21-128 (egtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683988 (Chr8:41947721..41947911 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCTGCTCGTCCAACCTTC Chr8:41947806..41947825 63.4 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683988 (Chr8:41947721..41947911 +)
Downstram Exon
ENSMUSE00000711976 (Chr8:41960302..41960398 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCTGCTCGTCCAACCTTC Chr8:41947806..41947825 63.4 60 GGAATCAAAAGCACGGAAAA Chr8:41960325..41960344 60.05 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683988 Chr8:41947721..41947911 CTGCTGCTCGTCCAACCTTC Chr8:41947806..41947825 63.4 60

*** Putative Vector Insertion (Chr 8: 41947912 - 41960301) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000711976 Chr8:41960302..41960398 GGAATCAAAAGCACGGAAAA Chr8:41960325..41960344 60.05 40
downstream ENSMUSE00000713622 Chr8:41983792..41984682 TACTTCACTGGCTGCACACC Chr8:41983957..41983976 59.9 55
downstream ENSMUSE00000473591 Chr8:41984291..41984682 CGAAAGTCAGCACTGCTCTG Chr8:41984340..41984359 59.92 55
downstream ENSMUSE00000719919 Chr8:41984291..41984682 CGAAAGTCAGCACTGCTCTG Chr8:41984340..41984359 59.92 55
downstream ENSMUSE00000211045 Chr8:41985410..41985565 CTCTTGCGACACTGGACGTA Chr8:41985433..41985452 60.05 55
downstream ENSMUSE00000211048 Chr8:41987853..41988018 CCATGACAAAGAGAAGGACCA Chr8:41987941..41987961 60.1 47.62
downstream ENSMUSE00000287877 Chr8:41989800..41989933 TTCCGTTCTCAGAAGGTGGT Chr8:41989825..41989844 59.7 50
downstream ENSMUSE00000287870 Chr8:41990859..41991081 GCGTTAAAGCTGCAGAAACC Chr8:41990963..41990982 60.03 50
downstream ENSMUSE00000637226 Chr8:41993410..41993549 CCCGACGACAAAGTAGCAAT Chr8:41993541..41993560 60.13 50
downstream ENSMUSE00000211053 Chr8:41993752..41993888 GCAAACAGAATTCGGGGTAA Chr8:41993796..41993815 59.94 45
downstream ENSMUSE00000211058 Chr8:41996349..41996451 CCATGAGGGTGCCAATAGAC Chr8:41996417..41996436 60.34 55
downstream ENSMUSE00000430975 Chr8:41997834..41998039 TGGGACTCGCTCTTCAAAGT Chr8:41997932..41997951 59.99 50
downstream ENSMUSE00000211046 Chr8:41999317..41999483 TGCCTCCAAATGGTCAGAAT Chr8:41999455..41999474 60.46 45
downstream ENSMUSE00000211055 Chr8:42000274..42000382 CGCACTTAACTGGACCATCA Chr8:42000348..42000367 59.72 50
downstream ENSMUSE00000683962 Chr8:42001692..42007423 GGGCAACTAGCATTTGTGGT Chr8:42003598..42003617 60 50
downstream ENSMUSE00000709846 Chr8:42001692..42007424 GGGCAACTAGCATTTGTGGT Chr8:42003598..42003617 60 50
downstream ENSMUSE00000718671 Chr8:42001692..42003080 TGTGATTCGGAGGCCTATTC Chr8:42002729..42002748 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr8:41959960..41959980 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACAGGCCTATGGACACTTT Chr8:41959902..41959923 59.61 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031596