Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29388
Trapped Gene
Ubxn4 (ENSMUSG00000026353)
Vector Insertion
Chr 1: 130148883 - 130152009
Public Clones NAISTrap_26v1018 (NAISTrap)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000158291 (Chr1:130148780..130148882 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCAAGTTGGGAAGATGAA Chr1:130148807..130148826 58.85 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000158291 (Chr1:130148780..130148882 +)
Downstram Exon
ENSMUSE00000158290 (Chr1:130152010..130152038 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCAAGTTGGGAAGATGAA Chr1:130148807..130148826 58.85 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000385394 Chr1:130140758..130141129 GTGACACAGGGGCGTACTTT Chr1:130140835..130140854 60.03 55
upstream ENSMUSE00000158291 Chr1:130148780..130148882 CTGCAAGTTGGGAAGATGAA Chr1:130148807..130148826 58.85 45

*** Putative Vector Insertion (Chr 1: 130148883 - 130152009) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158290 Chr1:130152010..130152038 No primer for this exon
downstream ENSMUSE00000158286 Chr1:130152696..130152814 TCCCCGCTATTACTTCCAAA Chr1:130152770..130152789 59.54 45
downstream ENSMUSE00000158284 Chr1:130155409..130155580 TTTGGACTCGGGATTTTCAC Chr1:130155525..130155544 59.91 45
downstream ENSMUSE00000158288 Chr1:130156021..130156114 AGTGGCTGTCATGACCTGTG Chr1:130156053..130156072 59.74 55
downstream ENSMUSE00000158289 Chr1:130157411..130157465 TCCTTCCGCTTCTCTTCTCTC Chr1:130157457..130157477 60.22 52.38
downstream ENSMUSE00000318763 Chr1:130159370..130159534 TCTCGAGCCGCTCTATCTTC Chr1:130159512..130159531 59.82 55
downstream ENSMUSE00000318758 Chr1:130162867..130162991 TGTCTTTGCAAAACGAGCAG Chr1:130162905..130162924 60.17 45
downstream ENSMUSE00000318754 Chr1:130166446..130166548 CAGCCGGAACTGAATTCTTG Chr1:130166476..130166495 60.77 50
downstream ENSMUSE00000318749 Chr1:130169398..130169529 GGGAAACATGGTGGCTAATG Chr1:130169448..130169467 60.19 50
downstream ENSMUSE00000318745 Chr1:130171379..130171581 GTGCAGGAGGAGGATTGCTA Chr1:130171517..130171536 60.36 55
downstream ENSMUSE00000338106 Chr1:130173534..130175954 GCTCGCTACCCTACATCTGC Chr1:130173685..130173704 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATTAATCGCCTTGCAGCAC Chr1:130151930..130151951 61.45 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTTCGTGACTGGGAAAACC Chr1:130151930..130151950 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026353