Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29400
Trapped Gene
Pde9a (ENSMUSG00000041119)
Vector Insertion
Chr 17: 31580854 - 31585311
Public Clones NAISTrap_15v1019 (NAISTrap)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000315987 (Chr17:31580783..31580853 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCCGAAGTTGCAAATCAC Chr17:31580806..31580825 60.26 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000315987 (Chr17:31580783..31580853 +)
Downstram Exon
ENSMUSE00000315965 (Chr17:31585312..31585396 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCCGAAGTTGCAAATCAC Chr17:31580806..31580825 60.26 45 AACTCCTCCCGCATCTTTTT Chr17:31585381..31585400 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000393277 Chr17:31523196..31523301 GGTGAAAAAGTCCAAGTGCAG Chr17:31523201..31523221 59.77 47.62
upstream ENSMUSE00000316049 Chr17:31551046..31551116 TCAGCAAGTACTGCAACTCCA Chr17:31551053..31551073 59.65 47.62
upstream ENSMUSE00000316035 Chr17:31552225..31552302 GAACACCACCATCTCCCTTTT Chr17:31552225..31552245 60.22 47.62
upstream ENSMUSE00000316020 Chr17:31557190..31557233 GGCTGTGAAGCAAGTGTCTG Chr17:31557214..31557233 59.62 55
upstream ENSMUSE00000316006 Chr17:31580111..31580165 No primer for this exon
upstream ENSMUSE00000315987 Chr17:31580783..31580853 AAGCCGAAGTTGCAAATCAC Chr17:31580806..31580825 60.26 45

*** Putative Vector Insertion (Chr 17: 31580854 - 31585311) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000315965 Chr17:31585312..31585396 AACTCCTCCCGCATCTTTTT Chr17:31585381..31585400 60.07 45
downstream ENSMUSE00000315946 Chr17:31590347..31590425 ACATCACGTCGAGGTGTCAA Chr17:31590412..31590431 60.16 50
downstream ENSMUSE00000315919 Chr17:31591999..31592073 TAGGGCTTCGATGGTCTCTG Chr17:31592034..31592053 60.35 55
downstream ENSMUSE00000315882 Chr17:31596020..31596106 GAAGTCCCTGACCAGACCAA Chr17:31596076..31596095 60.09 55
downstream ENSMUSE00000315854 Chr17:31596846..31596950 TGGAAGGGGTTGTTCCTGTA Chr17:31596886..31596905 60.35 50
downstream ENSMUSE00000315822 Chr17:31597124..31597206 TTGTTGTACCCTGGGTGGTC Chr17:31597206..31597225 60.67 55
downstream ENSMUSE00000315806 Chr17:31598516..31598672 GTTCTCCAGCGGTGAGATGT Chr17:31598582..31598601 60.27 55
downstream ENSMUSE00000315784 Chr17:31603300..31603413 ATGTCGGTAGCCAGGATCAA Chr17:31603334..31603353 60.48 50
downstream ENSMUSE00000315767 Chr17:31606739..31606843 GGACGGACTTCATTGGAGAT Chr17:31606791..31606810 58.94 50
downstream ENSMUSE00000315751 Chr17:31607626..31607754 CACTTTGTCTCGGTCCATGA Chr17:31607688..31607707 59.68 50
downstream ENSMUSE00000315729 Chr17:31608704..31608799 TGCTTCAGCTCCTCGTAGTG Chr17:31608780..31608799 59.34 55
downstream ENSMUSE00000315702 Chr17:31610103..31610224 GGAGAATGGCCTTCACTGTC Chr17:31610197..31610216 59.66 55
downstream ENSMUSE00000351292 Chr17:31612870..31613254 CACAGGCCACAATTCATCTG Chr17:31612911..31612930 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAACGGGTGGAATGTGAGT Chr17:31580841..31580861 59.83 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAACGGGTGGAATGTGAGT Chr17:31580841..31580861 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041119