Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29403
Trapped Gene
Mrps18b (ENSMUSG00000024436)
Vector Insertion
Chr 17: 36047902 - 36048363
Public Clones YHA116 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000142323 (Chr17:36048364..36048423 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAAGCAGCACAAGAAGCTG Chr17:36048395..36048414 60.47 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000142323 (Chr17:36048364..36048423 -)
Downstram Exon
ENSMUSE00000475086 (Chr17:36047331..36047901 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAAGCAGCACAAGAAGCTG Chr17:36048395..36048414 60.47 50 CCTTGATAGAGTCGGCGAAG Chr17:36047696..36047715 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000472037 Chr17:36053237..36053334 CGCTTCTAAAGCTGGTTCCT Chr17:36053267..36053286 58.74 50
upstream ENSMUSE00000142322 Chr17:36051641..36051749 ATATGAGAGCGAGCCTTGGA Chr17:36051659..36051678 59.94 50
upstream ENSMUSE00000142318 Chr17:36051437..36051534 CTATGGCTCTCGCCCTGTTT Chr17:36051502..36051521 61.65 55
upstream ENSMUSE00000142320 Chr17:36051279..36051347 AAAGTTGCTGGGAATCCTTG Chr17:36051319..36051338 59.17 45
upstream ENSMUSE00000142315 Chr17:36049283..36049349 TGCACACACGGGTATCATCT Chr17:36049301..36049320 59.99 50
upstream ENSMUSE00000142323 Chr17:36048364..36048423 TGAAGCAGCACAAGAAGCTG Chr17:36048395..36048414 60.47 50

*** Putative Vector Insertion (Chr 17: 36047902 - 36048363) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000475086 Chr17:36047331..36047901 CCTTGATAGAGTCGGCGAAG Chr17:36047696..36047715 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTTTCTGAGGTGCTTACG Chr17:36048321..36048341 59.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTTTCTGAGGTGCTTACG Chr17:36048321..36048341 59.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024436