Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29406
Trapped Gene
Mfn1 (ENSMUSG00000027668)
Vector Insertion
Chr 3: 32453231 - 32454395
Public Clones RRO496 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000271947 (Chr3:32453077..32453230 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTCGGAATCGGATCTTTT Chr3:32453148..32453167 60.17 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000271947 (Chr3:32453077..32453230 +)
Downstram Exon
ENSMUSE00000171980 (Chr3:32454396..32454463 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTCGGAATCGGATCTTTT Chr3:32453148..32453167 60.17 45 TCTTGCTTGAAATCCTTCTGC Chr3:32454429..32454449 59.58 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000271980 Chr3:32428408..32428617 AGCAGGGACGGAGTGAGTGT Chr3:32428467..32428486 62.28 60
upstream ENSMUSE00000599393 Chr3:32430476..32430938 TGTCGCATTGTCCAGGTAAA Chr3:32430494..32430513 60.11 45
upstream ENSMUSE00000271976 Chr3:32430820..32430938 TGAGGGCTCACATTTTGTTG Chr3:32430916..32430935 59.69 45
upstream ENSMUSE00000171966 Chr3:32433160..32433295 CGAGGATGATCTGGTGGAAA Chr3:32433197..32433216 61 50
upstream ENSMUSE00000171965 Chr3:32437192..32437354 GACCGAAGGGTCAGATGAAA Chr3:32437321..32437340 60.05 50
upstream ENSMUSE00000171964 Chr3:32441728..32441852 TGAAAGCTGGCTGTCTTGTG Chr3:32441771..32441790 60.17 50
upstream ENSMUSE00000569015 Chr3:32442989..32443097 TTGCAAACTCGGAATCAACA Chr3:32443066..32443085 60.23 40
upstream ENSMUSE00000271953 Chr3:32445510..32445617 TGAATAACCGTTGGGATGCT Chr3:32445568..32445587 60.33 45
upstream ENSMUSE00000271947 Chr3:32453077..32453230 AGCTCGGAATCGGATCTTTT Chr3:32453148..32453167 60.17 45

*** Putative Vector Insertion (Chr 3: 32453231 - 32454395) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171980 Chr3:32454396..32454463 TCTTGCTTGAAATCCTTCTGC Chr3:32454429..32454449 59.58 42.86
downstream ENSMUSE00000171968 Chr3:32460387..32460508 TTCACTGCTGACTGCGAGAT Chr3:32460415..32460434 59.73 50
downstream ENSMUSE00000171970 Chr3:32461934..32462060 TCCGTGACCTCCTTGATCTT Chr3:32462047..32462066 59.65 50
downstream ENSMUSE00000171979 Chr3:32462297..32462401 TGGGGGTAGGATGAAACTCA Chr3:32462381..32462400 60.31 50
downstream ENSMUSE00000171971 Chr3:32462715..32462817 GGTACACCGATCAGCCAAAT Chr3:32462774..32462793 59.82 50
downstream ENSMUSE00000271899 Chr3:32462998..32463227 GGAACCCAGGAATCGATGTA Chr3:32463182..32463201 59.75 50
downstream ENSMUSE00000171975 Chr3:32467179..32467331 CTGCTGGGTTAGAAGGAGCA Chr3:32467230..32467249 60.53 55
downstream ENSMUSE00000171972 Chr3:32468410..32468606 TCCACGTCAGCCTCTCATAA Chr3:32468497..32468516 59.39 50
downstream ENSMUSE00000171974 Chr3:32473156..32473290 No primer for this exon
downstream ENSMUSE00000569008 Chr3:32475985..32476598 GTCCGCTTCCTCCTACAGTG Chr3:32476095..32476114 59.87 60
downstream ENSMUSE00000718325 Chr3:32475985..32476275 GTCCGCTTCCTCCTACAGTG Chr3:32476095..32476114 59.87 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCATAAAGCTCAGGGGATG Chr3:32453201..32453222 60.59 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCATAAAGCTCAGGGGATG Chr3:32453201..32453222 60.59 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027668