Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29409
Trapped Gene
C1qtnf5 (ENSMUSG00000079592)
Vector Insertion
Chr 9: 43916377 - 43917270
Public Clones CMHD-GT_441F3-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700694 (Chr9:43916378..43917270 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTCTAGGTCCCTGACTCC Chr9:43917186..43917205 60.07 65 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700694 (Chr9:43916378..43917270 +)
Downstram Exon
ENSMUSE00000700704 (Chr9:43916378..43917269 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTCTAGGTCCCTGACTCC Chr9:43917186..43917205 60.07 65 CTCCGGGTTCACTGTGTTTT Chr9:43916916..43916935 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700697 Chr9:43915328..43915427 CTGGAGTTCTTGGCCTCTGA Chr9:43915339..43915358 60.52 55
upstream ENSMUSE00000700710 Chr9:43915329..43915544 AAGCCATTCAAAGCTTGCAG Chr9:43915499..43915518 60.52 45
upstream ENSMUSE00000700695 Chr9:43915399..43915455 GAGTCAGTCAGCAAGGACAGG Chr9:43915426..43915446 60.04 57.14
upstream ENSMUSE00000700709 Chr9:43915789..43916054 CTCCTCCTCTGGACGACAAC Chr9:43915887..43915906 59.83 60
upstream ENSMUSE00000722265 Chr9:43915789..43916054 CTCCTCCTCTGGACGACAAC Chr9:43915887..43915906 59.83 60

*** Putative Vector Insertion (Chr 9: 43916377 - 43917270) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000700694 Chr9:43916378..43917270 CTCCGGGTTCACTGTGTTTT Chr9:43916916..43916935 60.01 50
downstream ENSMUSE00000700696 Chr9:43916378..43917267 CTCCGGGTTCACTGTGTTTT Chr9:43916916..43916935 60.01 50
downstream ENSMUSE00000700704 Chr9:43916378..43917269 CTCCGGGTTCACTGTGTTTT Chr9:43916916..43916935 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGCGGCTCCTAATTTCTC Chr9:43916340..43916360 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGCGGCTCCTAATTTCTC Chr9:43916340..43916360 59.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079592