Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29410
Trapped Gene
Tspan5 (ENSMUSG00000028152)
Vector Insertion
Chr 3: 138561348 - 138565342
Public Clones CMHD-GT_441H2-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176789 (Chr3:138561231..138561347 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCATCGTGGCTGGTATTTTC Chr3:138561307..138561326 60.33 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176789 (Chr3:138561231..138561347 +)
Downstram Exon
ENSMUSE00000713354 (Chr3:138565343..138565621 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCATCGTGGCTGGTATTTTC Chr3:138561307..138561326 60.33 50 CAAGTTCCGTCTGTGAGCAG Chr3:138565600..138565619 59.62 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355602 Chr3:138405159..138405624 ATGTCCGGGAAGCACTACAA Chr3:138405544..138405563 60.52 50
upstream ENSMUSE00000720974 Chr3:138472838..138472988 TCAGCAGAAGGGATTCCTGA Chr3:138472950..138472969 60.88 50
upstream ENSMUSE00000713992 Chr3:138523457..138523631 AGATCGCAGGTGAAATTGCT Chr3:138523541..138523560 59.84 45
upstream ENSMUSE00000238498 Chr3:138531310..138531360 AACGTTTCTTGGAATCGGACT Chr3:138531321..138531341 59.99 42.86
upstream ENSMUSE00000709126 Chr3:138531310..138531360 AACGTTTCTTGGAATCGGACT Chr3:138531321..138531341 59.99 42.86
upstream ENSMUSE00000238489 Chr3:138553699..138553845 CCAGTGTGGCTTTTCCTTGT Chr3:138553747..138553766 60.15 50
upstream ENSMUSE00000176787 Chr3:138557312..138557482 GAACTCACTGCTGGGGTGTT Chr3:138557345..138557364 60.16 55
upstream ENSMUSE00000176780 Chr3:138559753..138559878 TGCACAGATTCCAATGCAAG Chr3:138559810..138559829 60.81 45
upstream ENSMUSE00000176783 Chr3:138561077..138561124 No primer for this exon
upstream ENSMUSE00000176789 Chr3:138561231..138561347 CCATCGTGGCTGGTATTTTC Chr3:138561307..138561326 60.33 50

*** Putative Vector Insertion (Chr 3: 138561348 - 138565342) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000398925 Chr3:138565343..138567388 TAAAACTCGCTTGGGCTTGT Chr3:138567314..138567333 59.88 45
downstream ENSMUSE00000713354 Chr3:138565343..138565621 CAAGTTCCGTCTGTGAGCAG Chr3:138565600..138565619 59.62 55
downstream ENSMUSE00000715489 Chr3:138565343..138566638 AGCCCTGACAGCTTCAATGT Chr3:138565402..138565421 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCATCGTGGCTGGTATTTT Chr3:138564307..138564327 59.32 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGACCGTGACTGGGAAAA Chr3:138564393..138564413 59.57 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028152