Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29412
Trapped Gene
Iqgap3 (ENSMUSG00000028068)
Vector Insertion
Chr 3: 87921707 - 87924084
Public Clones CMHD-GT_519G2-5S (cmhd) CMHD-GT_519G2-3 (cmhd) CMHD-GT_440E6-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000349037 (Chr3:87921598..87921706 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGGAAGGTTTTTCGTCAA Chr3:87921638..87921657 60.23 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000349037 (Chr3:87921598..87921706 +)
Downstram Exon
ENSMUSE00000513088 (Chr3:87924085..87924970 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGGAAGGTTTTTCGTCAA Chr3:87921638..87921657 60.23 45 ACCATGGTTCTTTGCAGGAC Chr3:87924428..87924447 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000462841 Chr3:87885973..87886014 No primer for this exon
upstream ENSMUSE00000516376 Chr3:87887853..87887940 ATGAGCAGAGGCGACAGAAT Chr3:87887880..87887899 59.98 50
upstream ENSMUSE00000469881 Chr3:87890072..87890228 TGTGCTTGAAGGAGGAGCTT Chr3:87890083..87890102 60.13 50
upstream ENSMUSE00000589832 Chr3:87891200..87891277 CTTTTGGCTCTCTGCGGTAG Chr3:87891238..87891257 60.15 55
upstream ENSMUSE00000589831 Chr3:87892816..87892892 ATGCCTCGGGTGATCTACTG Chr3:87892858..87892877 60.1 55
upstream ENSMUSE00000589830 Chr3:87893583..87893650 GATTGGCTCCACAGATCCAT Chr3:87893603..87893622 59.89 50
upstream ENSMUSE00000589829 Chr3:87893739..87893852 CAATGAGTTTTCAGCCGATG Chr3:87893824..87893843 59.27 45
upstream ENSMUSE00000567192 Chr3:87894060..87894238 GGGGAATCTTCGAGAACCTC Chr3:87894151..87894170 60.01 55
upstream ENSMUSE00000589828 Chr3:87894658..87894736 TGGTCAGGAGCAGGACATCT Chr3:87894663..87894682 60.83 55
upstream ENSMUSE00000589827 Chr3:87895393..87895556 GCTGACTTCAGACCGAGAGC Chr3:87895526..87895545 60.29 60
upstream ENSMUSE00000589826 Chr3:87896334..87896421 AGGGGGATGAAGAGCAAACT Chr3:87896401..87896420 60.07 50
upstream ENSMUSE00000589825 Chr3:87898506..87898669 GCTGTGTGGAGGATCAACAA Chr3:87898514..87898533 59.68 50
upstream ENSMUSE00000589824 Chr3:87900824..87900981 GAGGAGCTCTTTGTGGCTGT Chr3:87900836..87900855 59.6 55
upstream ENSMUSE00000175724 Chr3:87902240..87902361 CATCCTGAGCTGGAATGACC Chr3:87902291..87902310 60.62 55
upstream ENSMUSE00000402796 Chr3:87902779..87902942 GTTGCACCTCGGTACCATCT Chr3:87902889..87902908 60 55
upstream ENSMUSE00000175722 Chr3:87904548..87904638 AGAGCCAACGAGGACACAAG Chr3:87904605..87904624 60.44 55
upstream ENSMUSE00000175726 Chr3:87905350..87905517 GACAGAGCGTGTGTTGAGGA Chr3:87905405..87905424 60.03 55
upstream ENSMUSE00000175736 Chr3:87905600..87905739 CAGACCTTTCAGGGGACTTG Chr3:87905662..87905681 59.69 55
upstream ENSMUSE00000175721 Chr3:87905819..87905989 TCCTTGTTCGCCAGAAGTTT Chr3:87905916..87905935 59.85 45
upstream ENSMUSE00000175751 Chr3:87907982..87908065 CTCACTGGCGGGGTTATAGA Chr3:87907983..87908002 60.09 55
upstream ENSMUSE00000294182 Chr3:87908223..87908294 CTCAGGCGTCTGCGATACTT Chr3:87908265..87908284 60.56 55
upstream ENSMUSE00000175712 Chr3:87908388..87908457 AAGCCCGTGATGACTACAGG Chr3:87908431..87908450 60.13 55
upstream ENSMUSE00000413406 Chr3:87911434..87911642 CAAGATTGGTCTGCTCGTCA Chr3:87911603..87911622 59.98 50
upstream ENSMUSE00000175744 Chr3:87912283..87912435 CACTGCAAGAAGCTGACCAA Chr3:87912295..87912314 60.17 50
upstream ENSMUSE00000567198 Chr3:87912729..87912892 TTTGGCCAAGCTGATCTTTC Chr3:87912743..87912762 60.33 45
upstream ENSMUSE00000175745 Chr3:87913194..87913418 GGTGAGACTGGTGGTGAGGT Chr3:87913242..87913261 60.01 60
upstream ENSMUSE00000396089 Chr3:87913917..87914057 TTTGTCGCCATCAGTTCATC Chr3:87914023..87914042 59.65 45
upstream ENSMUSE00000589811 Chr3:87916226..87916310 CCACCGAGAGGGACATCTAT Chr3:87916288..87916307 58.97 55
upstream ENSMUSE00000387045 Chr3:87916520..87916752 GTGGTTGGGAACCTCCTGTA Chr3:87916520..87916539 59.82 55
upstream ENSMUSE00000332890 Chr3:87917022..87917154 GCTTCGCCATCGATGAATAC Chr3:87917066..87917085 60.58 50
upstream ENSMUSE00000386665 Chr3:87917269..87917371 CTTGCTCGAACACCAAGACC Chr3:87917271..87917290 60.83 55
upstream ENSMUSE00000589822 Chr3:87917846..87917972 TCCCTGACACTCACCAACAA Chr3:87917896..87917915 60.13 50
upstream ENSMUSE00000476100 Chr3:87918826..87918913 TCCCTGGAAGAGATCCTGAC Chr3:87918872..87918891 59.18 55
upstream ENSMUSE00000407129 Chr3:87919826..87920038 TGTCACTGTCGGAGAAGCAG Chr3:87919926..87919945 60.18 55
upstream ENSMUSE00000487103 Chr3:87920702..87920868 GACATCTGCAACCAGCGTAG Chr3:87920702..87920721 59.47 55
upstream ENSMUSE00000589821 Chr3:87921121..87921222 GAAGCAGCCGTCTCTTCACT Chr3:87921139..87921158 59.75 55
upstream ENSMUSE00000349037 Chr3:87921598..87921706 GCAGGAAGGTTTTTCGTCAA Chr3:87921638..87921657 60.23 45

*** Putative Vector Insertion (Chr 3: 87921707 - 87924084) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000513088 Chr3:87924085..87924970 ACCATGGTTCTTTGCAGGAC Chr3:87924428..87924447 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000028068