Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29438
Trapped Gene
Epm2a (ENSMUSG00000055493)
Vector Insertion
Chr 10: 11063567 - 11110608
Public Clones (sanger) CMHD-GT_413D1-3 (cmhd) CMHD-GT_419H4-3 (cmhd) CMHD-GT_413C12-3 (cmhd)
IST14633F11 (tigm) IST10221A4 (tigm) IST12056B2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000519882 (Chr10:11063202..11063566 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000519882 (Chr10:11063202..11063566 +)
Downstram Exon
ENSMUSE00000481937 (Chr10:11110609..11110783 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ATTTCATTGGTGTGCCCAGT Chr10:11110726..11110745 60.24 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000519882 Chr10:11063202..11063566 No primer for this exon

*** Putative Vector Insertion (Chr 10: 11063567 - 11110608) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000481937 Chr10:11110609..11110783 ATTTCATTGGTGTGCCCAGT Chr10:11110726..11110745 60.24 45
downstream ENSMUSE00000479924 Chr10:11168440..11168681 AGTGGGCATCCAGATGTAGG Chr10:11168665..11168684 59.95 55
downstream ENSMUSE00000419399 Chr10:11176938..11177520 CGTTGCAGTGGACATACACC Chr10:11177024..11177043 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGCCTTGGGACCTTCTAA Chr10:11075601..11075621 60.63 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTGACGTGACTGGGAAAAC Chr10:11075612..11075633 60 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055493