Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29452
Trapped Gene
Lsm14a (ENSMUSG00000066568)
Vector Insertion
Chr 7: 35160630 - 35174376
Public Clones YTC822 (baygenomics) IST14650B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000533543 (Chr7:35174377..35174559 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCGACACCGAGAACTCCAC Chr7:35174394..35174413 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000533543 (Chr7:35174377..35174559 -)
Downstram Exon
ENSMUSE00000675464 (Chr7:35160617..35160629 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCGACACCGAGAACTCCAC Chr7:35174394..35174413 60.12 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000533543 Chr7:35174377..35174559 ATCGACACCGAGAACTCCAC Chr7:35174394..35174413 60.12 55

*** Putative Vector Insertion (Chr 7: 35160630 - 35174376) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000675464 Chr7:35160617..35160629 No primer for this exon
downstream ENSMUSE00000533541 Chr7:35160248..35160411 GCGGTATTGGACGATCTGTT Chr7:35160342..35160361 59.96 50
downstream ENSMUSE00000533539 Chr7:35156074..35156203 CCACCGACTGGAATGAAGAT Chr7:35156142..35156161 59.93 50
downstream ENSMUSE00000533537 Chr7:35150634..35150756 GTCTTGTGTGAAGGCCGAAC Chr7:35150643..35150662 60.7 55
downstream ENSMUSE00000533535 Chr7:35142785..35142961 AGGCGGTCTGTACTGCTTGT Chr7:35142871..35142890 59.94 55
downstream ENSMUSE00000719430 Chr7:35142453..35142515 TTTTCTGGCCTTGGGACTTT Chr7:35142463..35142482 60.96 45
downstream ENSMUSE00000721241 Chr7:35142453..35142515 TTTTCTGGCCTTGGGACTTT Chr7:35142463..35142482 60.96 45
downstream ENSMUSE00000533527 Chr7:35138684..35138866 ACCATCTCGACGGATACCAA Chr7:35138762..35138781 60.34 50
downstream ENSMUSE00000675462 Chr7:35138684..35138866 ACCATCTCGACGGATACCAA Chr7:35138762..35138781 60.34 50
downstream ENSMUSE00000675461 Chr7:35138409..35138580 AGGGGATCTTCCTCATCAGC Chr7:35138453..35138472 60.56 55
downstream ENSMUSE00000712206 Chr7:35138409..35138580 AGGGGATCTTCCTCATCAGC Chr7:35138453..35138472 60.56 55
downstream ENSMUSE00000718902 Chr7:35138409..35138580 AGGGGATCTTCCTCATCAGC Chr7:35138453..35138472 60.56 55
downstream ENSMUSE00000533521 Chr7:35136305..35136536 AAACTCCCTACCACCACGAG Chr7:35136301..35136320 59.06 55
downstream ENSMUSE00000675466 Chr7:35136305..35136536 AAACTCCCTACCACCACGAG Chr7:35136301..35136320 59.06 55
downstream ENSMUSE00000533517 Chr7:35132945..35133001 TCCAGACCTTTTAGGGTCCA Chr7:35132946..35132965 59.52 50
downstream ENSMUSE00000675465 Chr7:35132945..35133001 TCCAGACCTTTTAGGGTCCA Chr7:35132946..35132965 59.52 50
downstream ENSMUSE00000533514 Chr7:35129738..35130977 GGTGCCAGAGGATTCTGAAA Chr7:35129821..35129840 60.19 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTACACTGGAGCCCCCAAC Chr7:35174326..35174346 61.13 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTTTCGTGACTGGGAAAA Chr7:35174311..35174331 58.05 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CACACACCTTAATCGCCTTG Chr7:35174498..35174518 59.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACTCTCGTGACTGGGAAAACC Chr7:35174493..35174514 60.54 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066568