Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29460
Trapped Gene
B3gnt2 (ENSMUSG00000051650)
Vector Insertion
Chr 11: 22734856 - 22759704
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) H001C07 (ggtc) E028B12 (ggtc) D111G12 (ggtc) (ggtc)
E114G05 (ggtc) D188C01 (ggtc) D106C05 (ggtc) (ggtc) (ggtc)
E068E02 (ggtc) D139D04 (ggtc) (ggtc) E125A04 (ggtc) E027F11 (ggtc)
D109F05 (ggtc) (ggtc) E114G05 (ggtc) D188C01 (ggtc) D106C05 (ggtc)
(ggtc) P151C09 (ggtc) E030B09 (ggtc) D111G12 (ggtc) (ggtc)
E125A04 (ggtc) E026B09 (ggtc) D109F05 (ggtc) (ggtc) E114A04 (ggtc)
D171C11 (ggtc) (ggtc) (cmhd) IST10891E9 (tigm) IST14784E11 (tigm)
IST11934G4 (tigm) IST11525D6 (tigm) IST12999G7 (tigm) IST14652C8 (tigm)
IST10284B7 (tigm) IST14982E3 (tigm) IST13441A9 (tigm) IST14784E11 (tigm)
IST14556B1 (tigm) IST13566F12 (tigm) IST14606G7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000370857 (Chr11:22759494..22759703 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCTGGAGGTGTCCCTAGA Chr11:22759498..22759517 59.4 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000370857 (Chr11:22759494..22759703 -)
Downstram Exon
ENSMUSE00000493466 (Chr11:22734857..22737195 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCTGGAGGTGTCCCTAGA Chr11:22759498..22759517 59.4 60 GCCCAGCAACTTGACTCTTC Chr11:22737129..22737148 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000331247 Chr11:22760218..22760336 AACCTGAAGGTCCGAAGAGG Chr11:22760292..22760311 60.62 55
upstream ENSMUSE00000370857 Chr11:22759494..22759703 GAGCTGGAGGTGTCCCTAGA Chr11:22759498..22759517 59.4 60
upstream ENSMUSE00000357467 Chr11:22734865..22737195 ATACGGGAATGTGCCTTCAG Chr11:22736164..22736183 59.96 50
upstream ENSMUSE00000493466 Chr11:22734857..22737195 ATACGGGAATGTGCCTTCAG Chr11:22736164..22736183 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTTGTGTAATCGCCTTGC Chr11:22753641..22753661 60.78 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTGTCGTGACTGGGAAAA Chr11:22753639..22753659 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGCTGGAGGTGTCCCTAGAC Chr11:22753495..22753515 58.34 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGCTGGAGGTGTCCCTAGAC Chr11:22753495..22753515 58.34 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051650