Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29461
Trapped Gene
Eef1d (ENSMUSG00000055762)
Vector Insertion
Chr 15: 75728535 - 75731193
Public Clones P151B02 (ggtc) P151B02 (ggtc) P134E05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000128508 (Chr15:75731121..75731192 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGATCCTCCGAGACATTGC Chr15:75731158..75731177 60.63 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000128508 (Chr15:75731121..75731192 -)
Downstram Exon
ENSMUSE00000505079 (Chr15:75728536..75731192 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGATCCTCCGAGACATTGC Chr15:75731158..75731177 60.63 55 GCGAGGTCCAGACTTCTTTG Chr15:75730454..75730473 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000400326 Chr15:75739675..75739736 CAGTTCCAGGTTTTGGTTGC Chr15:75739693..75739712 60.53 50
upstream ENSMUSE00000488860 Chr15:75739675..75739749 CAGTTCCAGGTTTTGGTTGC Chr15:75739693..75739712 60.53 50
upstream ENSMUSE00000706379 Chr15:75739675..75739720 CAGTTCCAGGTTTTGGTTGC Chr15:75739693..75739712 60.53 50
upstream ENSMUSE00000648543 Chr15:75736316..75736330 No primer for this exon
upstream ENSMUSE00000706369 Chr15:75733109..75734238 ACTCTTCGACCAGGCAGAAA Chr15:75733839..75733858 59.99 50
upstream ENSMUSE00000721585 Chr15:75733109..75734238 ACTCTTCGACCAGGCAGAAA Chr15:75733839..75733858 59.99 50
upstream ENSMUSE00000559539 Chr15:75731562..75731682 TAGCGCATGAGAAGATCTGG Chr15:75731643..75731662 59.13 50
upstream ENSMUSE00000648537 Chr15:75731562..75731685 TAGCGCATGAGAAGATCTGG Chr15:75731643..75731662 59.13 50
upstream ENSMUSE00000713616 Chr15:75731562..75731685 TAGCGCATGAGAAGATCTGG Chr15:75731643..75731662 59.13 50
upstream ENSMUSE00000714911 Chr15:75731562..75731685 TAGCGCATGAGAAGATCTGG Chr15:75731643..75731662 59.13 50
upstream ENSMUSE00000718319 Chr15:75731562..75731685 TAGCGCATGAGAAGATCTGG Chr15:75731643..75731662 59.13 50
upstream ENSMUSE00000128508 Chr15:75731121..75731192 GTGATCCTCCGAGACATTGC Chr15:75731158..75731177 60.63 55
upstream ENSMUSE00000706377 Chr15:75731121..75731192 GTGATCCTCCGAGACATTGC Chr15:75731158..75731177 60.63 55
upstream ENSMUSE00000505079 Chr15:75728536..75731192 CCCAAGTCCAAACTCGTGAT Chr15:75728606..75728625 59.97 50

*** Putative Vector Insertion (Chr 15: 75728535 - 75731193) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000559538 Chr15:75727656..75727712 No primer for this exon
downstream ENSMUSE00000128509 Chr15:75727250..75727349 ACTGTGGTCTCCACCAGGTC Chr15:75727283..75727302 60.01 60
downstream ENSMUSE00000706376 Chr15:75727250..75727349 ACTGTGGTCTCCACCAGGTC Chr15:75727283..75727302 60.01 60
downstream ENSMUSE00000128505 Chr15:75727070..75727170 GCTCGGGGAGTAGGTGAACT Chr15:75727067..75727086 60.65 60
downstream ENSMUSE00000706375 Chr15:75727070..75727170 GCTCGGGGAGTAGGTGAACT Chr15:75727067..75727086 60.65 60
downstream ENSMUSE00000128506 Chr15:75726673..75726894 TACTGGCGTAGCCTCTCCTC Chr15:75726718..75726737 59.6 60
downstream ENSMUSE00000706374 Chr15:75726673..75726894 TACTGGCGTAGCCTCTCCTC Chr15:75726718..75726737 59.6 60
downstream ENSMUSE00000128504 Chr15:75726162..75726356 CCCACTTTGTCATCCTCCAC Chr15:75726183..75726202 60.36 55
downstream ENSMUSE00000706373 Chr15:75726162..75726356 CCCACTTTGTCATCCTCCAC Chr15:75726183..75726202 60.36 55
downstream ENSMUSE00000706370 Chr15:75725922..75726021 TTGTTGAAAGCTGCGATGTC Chr15:75725968..75725987 59.99 45
downstream ENSMUSE00000559537 Chr15:75725920..75726021 TTGTTGAAAGCTGCGATGTC Chr15:75725968..75725987 59.99 45
downstream ENSMUSE00000706372 Chr15:75725920..75726021 TTGTTGAAAGCTGCGATGTC Chr15:75725968..75725987 59.99 45
downstream ENSMUSE00000559540 Chr15:75725230..75726021 TTGTTGAAAGCTGCGATGTC Chr15:75725968..75725987 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCACTGTCTGCAGGAGAA Chr15:75731186..75731206 60.33 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCACTGTCTGCAGGAGAA Chr15:75731186..75731206 60.33 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055762