Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29468
Trapped Gene
Ifrg15 (ENSMUSG00000079252)
Vector Insertion
Chr 1: 157888265 - 157898423
Public Clones (sanger) (sanger) (sanger) P148C04 (ggtc) IST13613A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000718943 (Chr1:157888205..157888264 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTACGGCACAAACAGAAA Chr1:157888240..157888259 61.05 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000718943 (Chr1:157888205..157888264 +)
Downstram Exon
ENSMUSE00000462618 (Chr1:157898424..157899927 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTACGGCACAAACAGAAA Chr1:157888240..157888259 61.05 50 CCTAGGCTACGAACGCAAAG Chr1:157899459..157899478 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000658985 Chr1:157882856..157883050 AGCCGAGACTGTTACCTTCG Chr1:157882873..157882892 59.5 55
upstream ENSMUSE00000688883 Chr1:157888024..157888132 CCTAGTGGTACCGCTGATCC Chr1:157888078..157888097 59.57 60
upstream ENSMUSE00000658978 Chr1:157888047..157888132 CCTAGTGGTACCGCTGATCC Chr1:157888078..157888097 59.57 60
upstream ENSMUSE00000718943 Chr1:157888205..157888264 CCCTACGGCACAAACAGAAA Chr1:157888240..157888259 61.05 50

*** Putative Vector Insertion (Chr 1: 157888265 - 157898423) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000462618 Chr1:157898424..157899927 CCTAGGCTACGAACGCAAAG Chr1:157899459..157899478 60.03 55
downstream ENSMUSE00000658977 Chr1:157898424..157900866 CCTAGGCTACGAACGCAAAG Chr1:157899459..157899478 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr1:157897315..157897335 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTCTTGGCAGCATGGTTT Chr1:157894221..157894241 60.62 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079252