Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29476
Trapped Gene
Akap1 (ENSMUSG00000018428)
Vector Insertion
Chr 11: 88705572 - 88712818
Public Clones P135C12 (ggtc) D048E06 (ggtc) P143G10 (ggtc) D048E06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674780 (Chr11:88712665..88712817 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674780 (Chr11:88712665..88712817 -)
Downstram Exon
ENSMUSE00000484863 (Chr11:88705573..88707179 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000586217 Chr11:88725711..88725900 No primer for this exon
upstream ENSMUSE00000674794 Chr11:88724964..88725031 No primer for this exon
upstream ENSMUSE00000674780 Chr11:88712665..88712817 No primer for this exon
upstream ENSMUSE00000484863 Chr11:88705573..88707179 No primer for this exon
upstream ENSMUSE00000674793 Chr11:88705573..88707179 No primer for this exon
upstream ENSMUSE00000721363 Chr11:88705573..88707179 No primer for this exon

*** Putative Vector Insertion (Chr 11: 88705572 - 88712818) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000674779 Chr11:88704943..88705010 No primer for this exon
downstream ENSMUSE00000106505 Chr11:88702483..88702616 No primer for this exon
downstream ENSMUSE00000106501 Chr11:88700939..88701065 No primer for this exon
downstream ENSMUSE00000106503 Chr11:88700244..88700371 No primer for this exon
downstream ENSMUSE00000106513 Chr11:88698326..88698503 No primer for this exon
downstream ENSMUSE00000106509 Chr11:88696394..88696544 No primer for this exon
downstream ENSMUSE00000106508 Chr11:88695976..88696043 No primer for this exon
downstream ENSMUSE00000264485 Chr11:88694456..88694529 No primer for this exon
downstream ENSMUSE00000264474 Chr11:88693622..88693684 No primer for this exon
downstream ENSMUSE00000402510 Chr11:88692106..88693143 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGACCGTGCAGAGATGAGAT Chr11:88709776..88709796 60.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGAGTCAGCTTGCTCAGACC Chr11:88709811..88709832 59.62 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018428