Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29495
Trapped Gene
6430526N21Rik (ENSMUSG00000074405)
Vector Insertion
Chr 7: 4972258 - 4981339
Public Clones (sanger) (sanger) P137B03 (ggtc) D187B05 (ggtc) E038A09 (ggtc)
D110G12 (ggtc) P137B03 (ggtc) D187B05 (ggtc) D110G12 (ggtc) IST14047B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677250 (Chr7:4972172..4972257 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677250 (Chr7:4972172..4972257 +)
Downstram Exon
ENSMUSE00000677248 (Chr7:4981340..4981431 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCGGATGAGACTGGAGACAT Chr7:4981417..4981436 60.23 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637483 Chr7:4971978..4972257 GTGTCTAGTGCCGGCGTAAT Chr7:4972034..4972053 60.16 55
upstream ENSMUSE00000677250 Chr7:4972172..4972257 No primer for this exon

*** Putative Vector Insertion (Chr 7: 4972258 - 4981339) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000465026 Chr7:4980593..4983809 GTGTTCCCCGTATAGCTCCA Chr7:4980775..4980794 59.96 55
downstream ENSMUSE00000538366 Chr7:4980593..4982881 GTGTTCCCCGTATAGCTCCA Chr7:4980775..4980794 59.96 55
downstream ENSMUSE00000677248 Chr7:4981340..4981431 GCGGATGAGACTGGAGACAT Chr7:4981417..4981436 60.23 55
downstream ENSMUSE00000677247 Chr7:4981676..4981739 GAGGTGGCTAGGCTTCTTGA Chr7:4981717..4981736 59.57 55
downstream ENSMUSE00000677246 Chr7:4982765..4982784 No primer for this exon
downstream ENSMUSE00000677245 Chr7:4982810..4982844 No primer for this exon
downstream ENSMUSE00000637480 Chr7:4983231..4983478 CCGCTAGGCTAGAAGACTGC Chr7:4983380..4983399 59.38 60
downstream ENSMUSE00000637482 Chr7:4984365..4984825 TCGGGGTCTCAAATCAGTTC Chr7:4984452..4984471 60.05 50
downstream ENSMUSE00000677249 Chr7:4984365..4984740 TCGGGGTCTCAAATCAGTTC Chr7:4984452..4984471 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAAGGGCTATTTCCGAAGG Chr7:4972234..4972254 60.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAAGGGCTATTTCCGAAGG Chr7:4972234..4972254 60.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074405