Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29513
Trapped Gene
AL844840.8 (ENSMUSG00000079286)
Vector Insertion
Chr 2: 72809604 - 72824774
Public Clones P120D03 (ggtc) D063H07 (ggtc) (cmhd) PST21512-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000690313 (Chr2:72824758..72824773 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000690313 (Chr2:72824758..72824773 -)
Downstram Exon
ENSMUSE00000690312 (Chr2:72809605..72809657 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690313 Chr2:72824758..72824773 No primer for this exon
upstream ENSMUSE00000690312 Chr2:72809605..72809657 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTCGAGTAGCCCAGGAACA Chr2:72812796..72812816 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTCGAGTAGCCCAGGAACA Chr2:72812796..72812816 59.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079286