Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29526
Trapped Gene
Rps7 (ENSMUSG00000061477)
Vector Insertion
Chr 12: 29319073 - 29320353
Public Clones P107E05 (ggtc) PST23277-NR (escells) PST21864-NL (escells) PST21826-NR (escells)
PST21775-NL (escells) PST16323-NL (escells) PST23103-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000499668 (Chr12:29320281..29320352 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTCGAGCTGGAGATGAACT Chr12:29320328..29320347 59.71 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000499668 (Chr12:29320281..29320352 -)
Downstram Exon
ENSMUSE00000513974 (Chr12:29319074..29319217 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTCGAGCTGGAGATGAACT Chr12:29320328..29320347 59.71 55 TTCACGAACTAGCCGGACTT Chr12:29319097..29319116 59.88 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000223026 Chr12:29320721..29320790 GAGAGCCGTCCCTCTTTCTAA Chr12:29320737..29320757 59.97 52.38
upstream ENSMUSE00000223019 Chr12:29320445..29320528 ACGAGTTCGAGTCTGGCATC Chr12:29320451..29320470 60.42 55
upstream ENSMUSE00000499668 Chr12:29320281..29320352 GCTCGAGCTGGAGATGAACT Chr12:29320328..29320347 59.71 55
upstream ENSMUSE00000513974 Chr12:29319074..29319217 CAAGCACGTGGTCTTCATTG Chr12:29319079..29319098 60.3 50

*** Putative Vector Insertion (Chr 12: 29319073 - 29320353) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000512557 Chr12:29318633..29318697 GCGCTTCTGCTTATTTTTCG Chr12:29318619..29318638 60.12 45
downstream ENSMUSE00000511888 Chr12:29316489..29316639 ACGGATCCTCTTACCCACAA Chr12:29316539..29316558 59.4 50
downstream ENSMUSE00000222983 Chr12:29315963..29316058 ACATCCTTGCCTGTGAGCTT Chr12:29315990..29316009 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCTCGAGCTGGAGATGAA Chr12:29320328..29320348 61.79 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGATGAACTCCGATCTCAAGG Chr12:29320314..29320336 60.21 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061477