Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29537
Trapped Gene
Hnrnpk (ENSMUSG00000021546)
Vector Insertion
Chr 13: 58501253 - 58501779
Public Clones P095A10 (ggtc) P095A10 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000614714 (Chr13:58501694..58501778 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000614714 (Chr13:58501694..58501778 -)
Downstram Exon
ENSMUSE00000614713 (Chr13:58501254..58501351 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000440896 Chr13:58503754..58503877 No primer for this exon
upstream ENSMUSE00000614714 Chr13:58501694..58501778 No primer for this exon
upstream ENSMUSE00000614713 Chr13:58501254..58501351 No primer for this exon

*** Putative Vector Insertion (Chr 13: 58501253 - 58501779) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000614712 Chr13:58500517..58500573 No primer for this exon
downstream ENSMUSE00000614711 Chr13:58499114..58499157 No primer for this exon
downstream ENSMUSE00000118841 Chr13:58498188..58498260 No primer for this exon
downstream ENSMUSE00000681791 Chr13:58497549..58497620 No primer for this exon
downstream ENSMUSE00000118840 Chr13:58496935..58497048 No primer for this exon
downstream ENSMUSE00000614710 Chr13:58496526..58496654 No primer for this exon
downstream ENSMUSE00000614709 Chr13:58495839..58496146 No primer for this exon
downstream ENSMUSE00000118863 Chr13:58495671..58495725 No primer for this exon
downstream ENSMUSE00000471735 Chr13:58495437..58495520 No primer for this exon
downstream ENSMUSE00000641643 Chr13:58495214..58495229 No primer for this exon
downstream ENSMUSE00000614707 Chr13:58495053..58495135 No primer for this exon
downstream ENSMUSE00000614706 Chr13:58494557..58494726 No primer for this exon
downstream ENSMUSE00000681792 Chr13:58494053..58494058 No primer for this exon
downstream ENSMUSE00000681790 Chr13:58493804..58493837 No primer for this exon
downstream ENSMUSE00000640848 Chr13:58493785..58493830 No primer for this exon
downstream ENSMUSE00000612259 Chr13:58493747..58493782 No primer for this exon
downstream ENSMUSE00000641642 Chr13:58493312..58493777 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGACCGAACAGCCAGAAGT Chr13:58501727..58501747 59.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGAAAATGGAGACCGAACA Chr13:58501736..58501757 60.1 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021546