Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29538
Trapped Gene
Rpl26 (ENSMUSG00000060938)
Vector Insertion
Chr 11: 68715315 - 68715771
Public Clones D045F01 (ggtc) P093G08 (ggtc) D045F01 (ggtc) P093G08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000651953 (Chr11:68715112..68715314 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCGGTCCGTGTCTTTCCTA Chr11:68715256..68715275 60.25 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000651953 (Chr11:68715112..68715314 +)
Downstram Exon
ENSMUSE00000528761 (Chr11:68715772..68715938 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCGGTCCGTGTCTTTCCTA Chr11:68715256..68715275 60.25 55 TGATCTTCCTCCGAATGTGA Chr11:68715867..68715886 59.17 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000651955 Chr11:68715097..68715126 No primer for this exon
upstream ENSMUSE00000651953 Chr11:68715112..68715314 CTCGGTCCGTGTCTTTCCTA Chr11:68715256..68715275 60.25 55

*** Putative Vector Insertion (Chr 11: 68715315 - 68715771) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000463615 Chr11:68715772..68715944 TGATCTTCCTCCGAATGTGA Chr11:68715867..68715886 59.17 45
downstream ENSMUSE00000528761 Chr11:68715772..68715938 TGATCTTCCTCCGAATGTGA Chr11:68715867..68715886 59.17 45
downstream ENSMUSE00000472310 Chr11:68716681..68716821 TTCTCTCGCTGGACTCGTTC Chr11:68716781..68716800 60.68 55
downstream ENSMUSE00000508921 Chr11:68717867..68718035 CCGTGCACGAGATGTCTCTA Chr11:68718015..68718034 60.01 55
downstream ENSMUSE00000651954 Chr11:68717867..68718012 CCGTGCACGAGATGTCTCTA Chr11:68718015..68718034 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTAAGGGGACCAGGTTCGT Chr11:68715302..68715322 60.22 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAAGGGGACCAGGTTCGTG Chr11:68715303..68715323 62.17 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060938