Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29546
Trapped Gene
Cntfr (ENSMUSG00000028444)
Vector Insertion
Chr 4: 41633828 - 41642475
Public Clones M122H05 (ggtc) IST14245D9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000660882 (Chr4:41642343..41642474 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000660882 (Chr4:41642343..41642474 -)
Downstram Exon
ENSMUSE00000660885 (Chr4:41633829..41633918 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCCTCCTCTCCAGACCAAAG Chr4:41633846..41633865 59.38 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000660886 Chr4:41644010..41644074 GTCTGTATCCTGGGGAGCTG Chr4:41644012..41644031 59.68 60
upstream ENSMUSE00000675346 Chr4:41644010..41644123 ATCACCAACGCTCCGTATTT Chr4:41644074..41644093 59.46 45
upstream ENSMUSE00000660882 Chr4:41642343..41642474 No primer for this exon
upstream ENSMUSE00000675345 Chr4:41642343..41642477 No primer for this exon
upstream ENSMUSE00000660885 Chr4:41633829..41633918 CCAGGAAGACTTTGGTCTGG Chr4:41633877..41633896 59.69 55

*** Putative Vector Insertion (Chr 4: 41633828 - 41642475) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000605086 Chr4:41622052..41622136 TGGACTGTGTTTCTGCGTGT Chr4:41622034..41622053 60.36 50
downstream ENSMUSE00000711160 Chr4:41622052..41622136 TGGACTGTGTTTCTGCGTGT Chr4:41622034..41622053 60.36 50
downstream ENSMUSE00000416099 Chr4:41617875..41618108 TATCAGCTGAGAGCCGTTGA Chr4:41617947..41617966 59.7 50
downstream ENSMUSE00000632943 Chr4:41616706..41616860 CTCCTCGAGGTTTCCATCAG Chr4:41616749..41616768 59.8 55
downstream ENSMUSE00000294045 Chr4:41610571..41610688 AAGCCCTTGGGGTAAGTGTT Chr4:41610612..41610631 59.86 50
downstream ENSMUSE00000179195 Chr4:41610233..41610399 GTGATGGCCGTAGTGTTGTG Chr4:41610231..41610250 60.03 55
downstream ENSMUSE00000179194 Chr4:41609004..41609167 CACCACGTTTTCTGGAGGAT Chr4:41609117..41609136 59.97 50
downstream ENSMUSE00000179193 Chr4:41605812..41605992 CACTCCATGTCCCAATCTCA Chr4:41605865..41605884 59.47 50
downstream ENSMUSE00000660884 Chr4:41605272..41605440 GGGTCACAGATCTTCGTGGT Chr4:41605358..41605377 59.97 55
downstream ENSMUSE00000660883 Chr4:41604532..41605183 TAGCTGCATGGTCCTCCTCT Chr4:41604932..41604951 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATAATCGCCTTGCAGCACAT Chr4:41642405..41642426 63.31 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCAGATTCCTCCATGTGC Chr4:41636434..41636454 59.64 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028444