Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29560
Trapped Gene
Tdrd7 (ENSMUSG00000035517)
Vector Insertion
Chr 4: 46023774 - 46025937
Public Clones H001A09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000337328 (Chr4:46023662..46023773 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTCTGCTCGCTTTCCTTTC Chr4:46023730..46023749 59.2 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000337328 (Chr4:46023662..46023773 +)
Downstram Exon
ENSMUSE00000386739 (Chr4:46025938..46026140 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTCTGCTCGCTTTCCTTTC Chr4:46023730..46023749 59.2 50 TTAGTGATTCCACCGCCTTC Chr4:46025994..46026013 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674419 Chr4:45978256..45978348 TGAGGAGCCAGCAGTCTACA Chr4:45978257..45978276 59.73 55
upstream ENSMUSE00000660791 Chr4:45985105..45985308 GCTTTAGGTGATTCCCAAGC Chr4:45985176..45985195 58.79 50
upstream ENSMUSE00000489965 Chr4:46000332..46000546 GGGATCGTATTACCCCGTCT Chr4:46000400..46000419 60.04 55
upstream ENSMUSE00000660790 Chr4:46000334..46000546 GGGATCGTATTACCCCGTCT Chr4:46000400..46000419 60.04 55
upstream ENSMUSE00000284984 Chr4:46001950..46002091 AAGCCATGCCGTTCTTTCTA Chr4:46002068..46002087 59.85 45
upstream ENSMUSE00000284973 Chr4:46002922..46003102 AAAGCCAAAGGCAACTCTCA Chr4:46002923..46002942 59.99 45
upstream ENSMUSE00000284969 Chr4:46005069..46005142 CTGCCCTACGGAAGTCAATG Chr4:46005123..46005142 60.65 55
upstream ENSMUSE00000284962 Chr4:46007179..46007396 ACCAAATATCACGCCTCCTG Chr4:46007204..46007223 59.96 50
upstream ENSMUSE00000660789 Chr4:46017989..46018572 CCCAAAGCATTTGAGGACAT Chr4:46018214..46018233 59.93 45
upstream ENSMUSE00000660788 Chr4:46020327..46020513 CAGAGTCACACCGATCCAGA Chr4:46020402..46020421 59.82 55
upstream ENSMUSE00000337328 Chr4:46023662..46023773 GTTCTGCTCGCTTTCCTTTC Chr4:46023730..46023749 59.2 50

*** Putative Vector Insertion (Chr 4: 46023774 - 46025937) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000386739 Chr4:46025938..46026140 TTAGTGATTCCACCGCCTTC Chr4:46025994..46026013 60.07 50
downstream ENSMUSE00000284925 Chr4:46029741..46029875 GGCACCTGGCAGTAGAGTGT Chr4:46029814..46029833 60.33 60
downstream ENSMUSE00000284917 Chr4:46031402..46031488 TCGTAACCATTTCCCTTTGC Chr4:46031485..46031504 59.94 45
downstream ENSMUSE00000284908 Chr4:46033677..46033811 GGATGTCGAATTGCCAGAGT Chr4:46033745..46033764 60.08 50
downstream ENSMUSE00000353156 Chr4:46036267..46036377 GCCAATGGACTGTGGAAGAT Chr4:46036311..46036330 59.93 50
downstream ENSMUSE00000404469 Chr4:46038529..46039031 CACAGGTCTGCGTTTGTGAT Chr4:46038644..46038663 59.75 50
downstream ENSMUSE00000350221 Chr4:46042519..46042679 ACTAGGGGCTGCACTTTCCT Chr4:46042632..46042651 60.27 55
downstream ENSMUSE00000492279 Chr4:46047168..46047633 TTCCGGTCCCAAGGATTAGT Chr4:46047291..46047310 60.68 50
downstream ENSMUSE00000674415 Chr4:46047168..46047627 TTCCGGTCCCAAGGATTAGT Chr4:46047291..46047310 60.68 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTGATAATCGCCTTGCAG Chr4:46023819..46023839 59.83 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000035517